Human IFNA2/IFN-alphaA/ IFNA ORF/cDNA clone-Lentivirus particle (NM_000605)

Pre-made Human IFNA2/IFN-alphaA/ IFNA Lentiviral expression plasmid for IFNA2 lentivirus packaging, IFNA2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to IFNA2/IFN-alphaA products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP004490 Human IFNA2 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP004490
Gene Name IFNA2
Accession Number NM_000605
Gene ID 3440
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 567 bp
Gene Alias IFN-alphaA, IFNA, IFNA2B, INFA2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCCTTGACCTTTGCTTTACTGGTGGCCCTCCTGGTGCTCAGCTGCAAGTCAAGCTGCTCTGTGGGCTGTGATCTGCCTCAAACCCACAGCCTGGGTAGCAGGAGGACCTTGATGCTCCTGGCACAGATGAGGAGAATCTCTCTTTTCTCCTGCTTGAAGGACAGACATGACTTTGGATTTCCCCAGGAGGAGTTTGGCAACCAGTTCCAAAAGGCTGAAACCATCCCTGTCCTCCATGAGATGATCCAGCAGATCTTCAATCTCTTCAGCACAAAGGACTCATCTGCTGCTTGGGATGAGACCCTCCTAGACAAATTCTACACTGAACTCTACCAGCAGCTGAATGACCTGGAAGCCTGTGTGATACAGGGGGTGGGGGTGACAGAGACTCCCCTGATGAAGGAGGACTCCATTCTGGCTGTGAGGAAATACTTCCAAAGAATCACTCTCTATCTGAAAGAGAAGAAATACAGCCCTTGTGCCTGGGAGGTTGTCAGAGCAGAAATCATGAGATCTTTTTCTTTGTCAACAAACTTGCAAGAAAGTTTAAGAAGTAAGGAATGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T63934-Ab Anti-IFNA2/ IFN-alphaA/ IFNAB functional antibody
    Target Antigen GM-Tg-g-T63934-Ag IFNA2 protein
    Cytokine cks-Tg-g-GM-T63934 IFNA2 interferon, alpha 2 (IFNA2) protein & antibody
    ORF Viral Vector pGMLP004490 Human IFNA2 Lentivirus plasmid
    ORF Viral Vector vGMLP004490 Human IFNA2 Lentivirus particle


    Target information

    Target ID GM-T63934
    Target Name IFNA2
    Gene ID 3440
    Gene Symbol and Synonyms IFN-alpha-2,IFN-alphaA,IFNA,IFNA2,IFNA2B,leIF A
    Uniprot Accession P01563
    Uniprot Entry Name IFNA2_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, Cytokine Target
    Disease Cancer
    Gene Ensembl ENSG00000188379
    Target Classification Tumor-associated antigen (TAA)

    This gene is a member of the alpha interferon gene cluster on chromosome 9. The encoded cytokine is a member of the type I interferon family that is produced in response to viral infection as a key part of the innate immune response with potent antiviral, antiproliferative and immunomodulatory properties. This cytokine, like other type I interferons, binds a plasma membrane receptor made of IFNAR1 and IFNAR2 that is ubiquitously expressed, and thus is able to act on virtually all body cells. The encoded protein is effective in reducing the symptoms and duration of the common cold and in treating many types of cancer, including some hematological malignancies and solid tumors. A deficiency of type I interferon in the blood is thought to be a hallmark of severe COVID-19 and may provide a rationale for a combined therapeutic approach. [provided by RefSeq, Aug 2020]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.