Human IFNA2/IFN-alphaA/ IFNA ORF/cDNA clone-Lentivirus particle (NM_000605)
Pre-made Human IFNA2/IFN-alphaA/ IFNA Lentiviral expression plasmid for IFNA2 lentivirus packaging, IFNA2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to IFNA2/IFN-alphaA products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP004490 | Human IFNA2 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP004490 |
Gene Name | IFNA2 |
Accession Number | NM_000605 |
Gene ID | 3440 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 567 bp |
Gene Alias | IFN-alphaA, IFNA, IFNA2B, INFA2 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGCCTTGACCTTTGCTTTACTGGTGGCCCTCCTGGTGCTCAGCTGCAAGTCAAGCTGCTCTGTGGGCTGTGATCTGCCTCAAACCCACAGCCTGGGTAGCAGGAGGACCTTGATGCTCCTGGCACAGATGAGGAGAATCTCTCTTTTCTCCTGCTTGAAGGACAGACATGACTTTGGATTTCCCCAGGAGGAGTTTGGCAACCAGTTCCAAAAGGCTGAAACCATCCCTGTCCTCCATGAGATGATCCAGCAGATCTTCAATCTCTTCAGCACAAAGGACTCATCTGCTGCTTGGGATGAGACCCTCCTAGACAAATTCTACACTGAACTCTACCAGCAGCTGAATGACCTGGAAGCCTGTGTGATACAGGGGGTGGGGGTGACAGAGACTCCCCTGATGAAGGAGGACTCCATTCTGGCTGTGAGGAAATACTTCCAAAGAATCACTCTCTATCTGAAAGAGAAGAAATACAGCCCTTGTGCCTGGGAGGTTGTCAGAGCAGAAATCATGAGATCTTTTTCTTTGTCAACAAACTTGCAAGAAAGTTTAAGAAGTAAGGAATGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T63934-Ab | Anti-IFNA2/ IFN-alphaA/ IFNAB functional antibody |
Target Antigen | GM-Tg-g-T63934-Ag | IFNA2 protein |
Cytokine | cks-Tg-g-GM-T63934 | IFNA2 interferon, alpha 2 (IFNA2) protein & antibody |
ORF Viral Vector | pGMLP004490 | Human IFNA2 Lentivirus plasmid |
ORF Viral Vector | vGMLP004490 | Human IFNA2 Lentivirus particle |
Target information
Target ID | GM-T63934 |
Target Name | IFNA2 |
Gene ID | 3440 |
Gene Symbol and Synonyms | IFN-alpha-2,IFN-alphaA,IFNA,IFNA2,IFNA2B,leIF A |
Uniprot Accession | P01563 |
Uniprot Entry Name | IFNA2_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target, Cytokine Target |
Disease | Cancer |
Gene Ensembl | ENSG00000188379 |
Target Classification | Tumor-associated antigen (TAA) |
This gene is a member of the alpha interferon gene cluster on chromosome 9. The encoded cytokine is a member of the type I interferon family that is produced in response to viral infection as a key part of the innate immune response with potent antiviral, antiproliferative and immunomodulatory properties. This cytokine, like other type I interferons, binds a plasma membrane receptor made of IFNAR1 and IFNAR2 that is ubiquitously expressed, and thus is able to act on virtually all body cells. The encoded protein is effective in reducing the symptoms and duration of the common cold and in treating many types of cancer, including some hematological malignancies and solid tumors. A deficiency of type I interferon in the blood is thought to be a hallmark of severe COVID-19 and may provide a rationale for a combined therapeutic approach. [provided by RefSeq, Aug 2020]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.