Human IGFBP1/AFBP/ hIGFBP-1 ORF/cDNA clone-Lentivirus particle (NM_000596)

Pre-made Human IGFBP1/AFBP/ hIGFBP-1 Lentiviral expression plasmid for IGFBP1 lentivirus packaging, IGFBP1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to IGFBP1/AFBP products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP004491 Human IGFBP1 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP004491
Gene Name IGFBP1
Accession Number NM_000596
Gene ID 3484
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 780 bp
Gene Alias AFBP, hIGFBP-1, IBP1, IGF-BP25, PP12
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGTCAGAGGTCCCCGTTGCTCGCGTCTGGCTGGTACTGCTCCTGCTGACTGTCCAGGTCGGCGTGACAGCCGGCGCTCCGTGGCAGTGCGCGCCCTGCTCCGCCGAGAAGCTCGCGCTCTGCCCGCCGGTGTCCGCCTCGTGCTCGGAGGTCACCCGGTCCGCCGGCTGCGGCTGTTGCCCGATGTGCGCCCTGCCTCTGGGCGCCGCGTGCGGCGTGGCGACTGCACGCTGCGCCCGGGGACTCAGTTGCCGCGCGCTGCCGGGGGAGCAGCAACCTCTGCACGCCCTCACCCGCGGCCAAGGCGCCTGCGTGCAGGAGTCTGACGCCTCCGCTCCCCATGCTGCAGAGGCAGGGAGCCCTGAAAGCCCAGAGAGCACGGAGATAACTGAGGAGGAGCTCCTGGATAATTTCCATCTGATGGCCCCTTCTGAAGAGGATCATTCCATCCTTTGGGACGCCATCAGTACCTATGATGGCTCGAAGGCTCTCCATGTCACCAACATCAAAAAATGGAAGGAGCCCTGCCGAATAGAACTCTACAGAGTCGTAGAGAGTTTAGCCAAGGCACAGGAGACATCAGGAGAAGAAATTTCCAAATTTTACCTGCCAAACTGCAACAAGAATGGATTTTATCACAGCAGACAGTGTGAGACATCCATGGATGGAGAGGCGGGACTCTGCTGGTGCGTCTACCCTTGGAATGGGAAGAGGATCCCTGGGTCTCCAGAGATCAGGGGAGACCCCAACTGCCAGATATATTTTAATGTACAAAACTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T15048-Ab Anti-IBP1/ IGFBP1/ AFBP functional antibody
    Target Antigen GM-Tg-g-T15048-Ag IGFBP1 protein
    Cytokine cks-Tg-g-GM-T15048 insulin-like growth factor binding protein 1 (IGFBP1) protein & antibody
    ORF Viral Vector pGMLP004491 Human IGFBP1 Lentivirus plasmid
    ORF Viral Vector vGMLP004491 Human IGFBP1 Lentivirus particle


    Target information

    Target ID GM-T15048
    Target Name IGFBP1
    Gene ID 3484, 16006, 696994, 25685, 101101629, 480812, 282259, 100034154
    Gene Symbol and Synonyms AFBP,hIGFBP-1,IBP1,IGF-BP25,IGFBA,IGFBP-1,IGFBP1,PP12
    Uniprot Accession P08833
    Uniprot Entry Name IBP1_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, Diagnostics Biomarker, Cytokine Target
    Disease Ovary Cancer, Non-small cell lung carcinoma
    Gene Ensembl ENSG00000146678
    Target Classification Not Available

    This gene is a member of the insulin-like growth factor binding protein (IGFBP) family and encodes a protein with an IGFBP N-terminal domain and a thyroglobulin type-I domain. The encoded protein, mainly expressed in the liver, circulates in the plasma and binds both insulin-like growth factors (IGFs) I and II, prolonging their half-lives and altering their interaction with cell surface receptors. This protein is important in cell migration and metabolism. Low levels of this protein may be associated with impaired glucose tolerance, vascular disease and hypertension in human patients. [provided by RefSeq, Aug 2017]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.