Human IGFBP1/AFBP/ hIGFBP-1 ORF/cDNA clone-Lentivirus particle (NM_000596)
Pre-made Human IGFBP1/AFBP/ hIGFBP-1 Lentiviral expression plasmid for IGFBP1 lentivirus packaging, IGFBP1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to IGFBP1/AFBP products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP004491 | Human IGFBP1 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP004491 |
Gene Name | IGFBP1 |
Accession Number | NM_000596 |
Gene ID | 3484 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 780 bp |
Gene Alias | AFBP, hIGFBP-1, IBP1, IGF-BP25, PP12 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGTCAGAGGTCCCCGTTGCTCGCGTCTGGCTGGTACTGCTCCTGCTGACTGTCCAGGTCGGCGTGACAGCCGGCGCTCCGTGGCAGTGCGCGCCCTGCTCCGCCGAGAAGCTCGCGCTCTGCCCGCCGGTGTCCGCCTCGTGCTCGGAGGTCACCCGGTCCGCCGGCTGCGGCTGTTGCCCGATGTGCGCCCTGCCTCTGGGCGCCGCGTGCGGCGTGGCGACTGCACGCTGCGCCCGGGGACTCAGTTGCCGCGCGCTGCCGGGGGAGCAGCAACCTCTGCACGCCCTCACCCGCGGCCAAGGCGCCTGCGTGCAGGAGTCTGACGCCTCCGCTCCCCATGCTGCAGAGGCAGGGAGCCCTGAAAGCCCAGAGAGCACGGAGATAACTGAGGAGGAGCTCCTGGATAATTTCCATCTGATGGCCCCTTCTGAAGAGGATCATTCCATCCTTTGGGACGCCATCAGTACCTATGATGGCTCGAAGGCTCTCCATGTCACCAACATCAAAAAATGGAAGGAGCCCTGCCGAATAGAACTCTACAGAGTCGTAGAGAGTTTAGCCAAGGCACAGGAGACATCAGGAGAAGAAATTTCCAAATTTTACCTGCCAAACTGCAACAAGAATGGATTTTATCACAGCAGACAGTGTGAGACATCCATGGATGGAGAGGCGGGACTCTGCTGGTGCGTCTACCCTTGGAATGGGAAGAGGATCCCTGGGTCTCCAGAGATCAGGGGAGACCCCAACTGCCAGATATATTTTAATGTACAAAACTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T15048-Ab | Anti-IBP1/ IGFBP1/ AFBP functional antibody |
Target Antigen | GM-Tg-g-T15048-Ag | IGFBP1 protein |
Cytokine | cks-Tg-g-GM-T15048 | insulin-like growth factor binding protein 1 (IGFBP1) protein & antibody |
ORF Viral Vector | pGMLP004491 | Human IGFBP1 Lentivirus plasmid |
ORF Viral Vector | vGMLP004491 | Human IGFBP1 Lentivirus particle |
Target information
Target ID | GM-T15048 |
Target Name | IGFBP1 |
Gene ID | 3484, 16006, 696994, 25685, 101101629, 480812, 282259, 100034154 |
Gene Symbol and Synonyms | AFBP,hIGFBP-1,IBP1,IGF-BP25,IGFBA,IGFBP-1,IGFBP1,PP12 |
Uniprot Accession | P08833 |
Uniprot Entry Name | IBP1_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target, Diagnostics Biomarker, Cytokine Target |
Disease | Ovary Cancer, Non-small cell lung carcinoma |
Gene Ensembl | ENSG00000146678 |
Target Classification | Not Available |
This gene is a member of the insulin-like growth factor binding protein (IGFBP) family and encodes a protein with an IGFBP N-terminal domain and a thyroglobulin type-I domain. The encoded protein, mainly expressed in the liver, circulates in the plasma and binds both insulin-like growth factors (IGFs) I and II, prolonging their half-lives and altering their interaction with cell surface receptors. This protein is important in cell migration and metabolism. Low levels of this protein may be associated with impaired glucose tolerance, vascular disease and hypertension in human patients. [provided by RefSeq, Aug 2017]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.