Human KLRC2/CD159c/NKG2-C ORF/cDNA clone-Lentivirus particle (NM_002260)

Cat. No.: vGMLP004493

Pre-made Human KLRC2/CD159c/NKG2-C Lentiviral expression plasmid for KLRC2 lentivirus packaging, KLRC2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to KLRC2/CD159c products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP004493 Human KLRC2 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP004493
Gene Name KLRC2
Accession Number NM_002260
Gene ID 3822
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 696 bp
Gene Alias CD159c,NKG2-C,NKG2C
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAATAAACAAAGAGGAACCTTCTCAGAAGTGAGTCTGGCCCAGGACCCAAAGCGGCAGCAAAGGAAACCTAAAGGCAATAAAAGCTCCATTTCAGGAACCGAACAGGAAATATTCCAAGTAGAATTAAATCTTCAAAATCCTTCCCTGAATCATCAAGGGATTGATAAAATATATGACTGCCAAGGTTTACTGCCACCTCCAGAGAAGCTCACTGCCGAGGTCCTAGGAATCATTTGCATTGTCCTGATGGCCACTGTGTTAAAAACAATAGTTCTTATTCCTTTCCTGGAGCAGAACAATTTTTCCCCGAATACAAGAACGCAGAAAGCACGTCATTGTGGCCATTGTCCTGAGGAGTGGATTACATATTCCAACAGTTGTTATTACATTGGTAAGGAAAGAAGAACTTGGGAAGAGAGTTTGCTGGCCTGTACTTCGAAGAACTCCAGTCTGCTTTCTATAGATAATGAAGAAGAAATGAAATTTCTGGCCAGCATTTTACCTTCCTCATGGATTGGTGTGTTTCGTAACAGCAGTCATCATCCATGGGTGACAATAAATGGTTTGGCTTTCAAACATAAGATAAAAGACTCAGATAATGCTGAACTTAACTGTGCAGTGCTACAAGTAAATCGACTTAAATCAGCCCAGTGTGGATCTTCAATGATATATCATTGTAAGCATAAGCTTTAG
ORF Protein Sequence MNKQRGTFSEVSLAQDPKRQQRKPKGNKSSISGTEQEIFQVELNLQNPSLNHQGIDKIYDCQGLLPPPEKLTAEVLGIICIVLMATVLKTIVLIPFLEQNNFSPNTRTQKARHCGHCPEEWITYSNSCYYIGKERRTWEESLLACTSKNSSLLSIDNEEEMKFLASILPSSWIGVFRNSSHHPWVTINGLAFKHKIKDSDNAELNCAVLQVNRLKSAQCGSSMIYHCKHKL

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP0711-Ab Anti-NKG2C/ KLRC2/ CD159c monoclonal antibody
    Target Antigen GM-Tg-g-MP0711-Ag KLRC2 VLP (virus-like particle)
    ORF Viral Vector pGMLP004493 Human KLRC2 Lentivirus plasmid
    ORF Viral Vector vGMLP004493 Human KLRC2 Lentivirus particle


    Target information

    Target ID GM-MP0711
    Target Name KLRC2
    Gene ID 3822, 114670780
    Gene Symbol and Synonyms CD159c,KLRC2,NKG2-C,NKG2C
    Uniprot Accession P26717
    Uniprot Entry Name NKG2C_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000205809
    Target Classification Not Available

    Natural killer (NK) cells are lymphocytes that can mediate lysis of certain tumor cells and virus-infected cells without previous activation. They can also regulate specific humoral and cell-mediated immunity. NK cells preferentially express several calcium-dependent (C-type) lectins, which have been implicated in the regulation of NK cell function. The group, designated KLRC (NKG2) are expressed primarily in natural killer (NK) cells and encodes a family of transmembrane proteins characterized by a type II membrane orientation (extracellular C terminus) and the presence of a C-type lectin domain. The KLRC (NKG2) gene family is located within the NK complex, a region that contains several C-type lectin genes preferentially expressed on NK cells. KLRC2 alternative splice variants have been described but their full-length nature has not been determined. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.