Human CSF3/C17orf33/ CSF3OS ORF/cDNA clone-Lentivirus particle (NM_000759)

Pre-made Human CSF3/C17orf33/ CSF3OS Lentiviral expression plasmid for CSF3 lentivirus packaging, CSF3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to CSF3/C17orf33 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP004541 Human CSF3 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP004541
Gene Name CSF3
Accession Number NM_000759
Gene ID 1440
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 624 bp
Gene Alias C17orf33, CSF3OS, GCSF
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCTGGACCTGCCACCCAGAGCCCCATGAAGCTGATGGCCCTGCAGCTGCTGCTGTGGCACAGTGCACTCTGGACAGTGCAGGAAGCCACCCCCCTGGGCCCTGCCAGCTCCCTGCCCCAGAGCTTCCTGCTCAAGTGCTTAGAGCAAGTGAGGAAGATCCAGGGCGATGGCGCAGCGCTCCAGGAGAAGCTGGTGAGTGAGTGTGCCACCTACAAGCTGTGCCACCCCGAGGAGCTGGTGCTGCTCGGACACTCTCTGGGCATCCCCTGGGCTCCCCTGAGCAGCTGCCCCAGCCAGGCCCTGCAGCTGGCAGGCTGCTTGAGCCAACTCCATAGCGGCCTTTTCCTCTACCAGGGGCTCCTGCAGGCCCTGGAAGGGATCTCCCCCGAGTTGGGTCCCACCTTGGACACACTGCAGCTGGACGTCGCCGACTTTGCCACCACCATCTGGCAGCAGATGGAAGAACTGGGAATGGCCCCTGCCCTGCAGCCCACCCAGGGTGCCATGCCGGCCTTCGCCTCTGCTTTCCAGCGCCGGGCAGGAGGGGTCCTGGTTGCCTCCCATCTGCAGAGCTTCCTGGAGGTGTCGTACCGCGTTCTACGCCACCTTGCCCAGCCCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T19615-Ab Anti-CSF3/ C17orf33OS/ GCSF functional antibody
    Target Antigen GM-Tg-g-T19615-Ag CSF3 protein
    ORF Viral Vector pGMLP004541 Human CSF3 Lentivirus plasmid
    ORF Viral Vector vGMLP004541 Human CSF3 Lentivirus particle


    Target information

    Target ID GM-T19615
    Target Name CSF3
    Gene ID 1440, 12985, 698961, 25610, 493700, 608246, 281096, 100033922
    Gene Symbol and Synonyms C17orf33,CSF3,CSF3OS,Csfg,G-CSF,GCSF,MGI-IG
    Uniprot Accession P09919
    Uniprot Entry Name CSF3_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target
    Disease metastatic tumors
    Gene Ensembl ENSG00000108342
    Target Classification Not Available

    This gene encodes a member of the IL-6 superfamily of cytokines. The encoded cytokine controls the production, differentiation, and function of granulocytes. Granulocytes are a type of white blood cell that are part of the innate immune response. A modified form of this protein is commonly administered to manage chemotherapy-induced neutropenia. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, May 2020]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.