Human ICAM2/CD102 ORF/cDNA clone-Lentivirus particle (NM_000873)
Cat. No.: vGMLP004573
Pre-made Human ICAM2/CD102 Lentiviral expression plasmid for ICAM2 lentivirus packaging, ICAM2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
ICAM2/CD102 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
| Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
|---|---|---|---|
| vGMLP004573 | Human ICAM2 Lentivirus particle | Pilot Grade | 1.0E+8TU |
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| Research Grade | 1.0E+8TU | ||
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMLP004573 |
| Gene Name | ICAM2 |
| Accession Number | NM_000873 |
| Gene ID | 3384 |
| Species | Human |
| Product Type | Lentivirus particle (overexpression) |
| Insert Length | 828 bp |
| Gene Alias | CD102 |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGTCCTCTTTCGGTTACAGGACCCTGACTGTGGCCCTCTTCACCCTGATCTGCTGTCCAGGATCGGATGAGAAGGTATTCGAGGTACACGTGAGGCCAAAGAAGCTGGCGGTTGAGCCCAAAGGGTCCCTCGAGGTCAACTGCAGCACCACCTGTAACCAGCCTGAAGTGGGTGGTCTGGAGACCTCTCTAGATAAGATTCTGCTGGACGAACAGGCTCAGTGGAAACATTACTTGGTCTCAAACATCTCCCATGACACGGTCCTCCAATGCCACTTCACCTGCTCCGGGAAGCAGGAGTCAATGAATTCCAACGTCAGCGTGTACCAGCCTCCAAGGCAGGTCATCCTGACACTGCAACCCACTTTGGTGGCTGTGGGCAAGTCCTTCACCATTGAGTGCAGGGTGCCCACCGTGGAGCCCCTGGACAGCCTCACCCTCTTCCTGTTCCGTGGCAATGAGACTCTGCACTATGAGACCTTCGGGAAGGCAGCCCCTGCTCCGCAGGAGGCCACAGCCACATTCAACAGCACGGCTGACAGAGAGGATGGCCACCGCAACTTCTCCTGCCTGGCTGTGCTGGACTTGATGTCTCGCGGTGGCAACATCTTTCACAAACACTCAGCCCCGAAGATGTTGGAGATCTATGAGCCTGTGTCGGACAGCCAGATGGTCATCATAGTCACGGTGGTGTCGGTGTTGCTGTCCCTGTTCGTGACATCTGTCCTGCTCTGCTTCATCTTCGGCCAGCACTTGCGCCAGCAGCGGATGGGCACCTACGGGGTGCGAGCGGCTTGGAGGAGGCTGCCCCAGGCCTTCCGGCCATAG |
| ORF Protein Sequence | MSSFGYRTLTVALFTLICCPGSDEKVFEVHVRPKKLAVEPKGSLEVNCSTTCNQPEVGGLETSLDKILLDEQAQWKHYLVSNISHDTVLQCHFTCSGKQESMNSNVSVYQPPRQVILTLQPTLVAVGKSFTIECRVPTVEPLDSLTLFLFRGNETLHYETFGKAAPAPQEATATFNSTADREDGHRNFSCLAVLDLMSRGGNIFHKHSAPKMLEIYEPVSDSQMVIIVTVVSVLLSLFVTSVLLCFIFGQHLRQQRMGTYGVRAAWRRLPQAFRP |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-MP0597-Ab | Anti-ICAM2/ CD102 monoclonal antibody |
| Target Antigen | GM-Tg-g-MP0597-Ag | ICAM2 VLP (virus-like particle) |
| ORF Viral Vector | pGMLP004573 | Human ICAM2 Lentivirus plasmid |
| ORF Viral Vector | vGMLP004573 | Human ICAM2 Lentivirus particle |
Target information
| Target ID | GM-MP0597 |
| Target Name | ICAM2 |
| Gene ID | 3384, 15896, 574158, 360647, 101098907, 119873251, 100064400 |
| Gene Symbol and Synonyms | CD102,Icam-2,ICAM2,Ly-60 |
| Uniprot Accession | P13598 |
| Uniprot Entry Name | ICAM2_HUMAN |
| Protein Sub-location | Transmembrane Protein |
| Category | Not Available |
| Disease | Not Available |
| Gene Ensembl | ENSG00000108622 |
| Target Classification | Not Available |
The protein encoded by this gene is a member of the intercellular adhesion molecule (ICAM) family. All ICAM proteins are type I transmembrane glycoproteins, contain 2-9 immunoglobulin-like C2-type domains, and bind to the leukocyte adhesion LFA-1 protein. This protein may play a role in lymphocyte recirculation by blocking LFA-1-dependent cell adhesion. It mediates adhesive interactions important for antigen-specific immune response, NK-cell mediated clearance, lymphocyte recirculation, and other cellular interactions important for immune response and surveillance. Several transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


