Human ICAM2/CD102 ORF/cDNA clone-Lentivirus particle (NM_000873)

Cat. No.: vGMLP004573

Pre-made Human ICAM2/CD102 Lentiviral expression plasmid for ICAM2 lentivirus packaging, ICAM2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to ICAM2/CD102 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP004573 Human ICAM2 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP004573
Gene Name ICAM2
Accession Number NM_000873
Gene ID 3384
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 828 bp
Gene Alias CD102
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGTCCTCTTTCGGTTACAGGACCCTGACTGTGGCCCTCTTCACCCTGATCTGCTGTCCAGGATCGGATGAGAAGGTATTCGAGGTACACGTGAGGCCAAAGAAGCTGGCGGTTGAGCCCAAAGGGTCCCTCGAGGTCAACTGCAGCACCACCTGTAACCAGCCTGAAGTGGGTGGTCTGGAGACCTCTCTAGATAAGATTCTGCTGGACGAACAGGCTCAGTGGAAACATTACTTGGTCTCAAACATCTCCCATGACACGGTCCTCCAATGCCACTTCACCTGCTCCGGGAAGCAGGAGTCAATGAATTCCAACGTCAGCGTGTACCAGCCTCCAAGGCAGGTCATCCTGACACTGCAACCCACTTTGGTGGCTGTGGGCAAGTCCTTCACCATTGAGTGCAGGGTGCCCACCGTGGAGCCCCTGGACAGCCTCACCCTCTTCCTGTTCCGTGGCAATGAGACTCTGCACTATGAGACCTTCGGGAAGGCAGCCCCTGCTCCGCAGGAGGCCACAGCCACATTCAACAGCACGGCTGACAGAGAGGATGGCCACCGCAACTTCTCCTGCCTGGCTGTGCTGGACTTGATGTCTCGCGGTGGCAACATCTTTCACAAACACTCAGCCCCGAAGATGTTGGAGATCTATGAGCCTGTGTCGGACAGCCAGATGGTCATCATAGTCACGGTGGTGTCGGTGTTGCTGTCCCTGTTCGTGACATCTGTCCTGCTCTGCTTCATCTTCGGCCAGCACTTGCGCCAGCAGCGGATGGGCACCTACGGGGTGCGAGCGGCTTGGAGGAGGCTGCCCCAGGCCTTCCGGCCATAG
ORF Protein Sequence MSSFGYRTLTVALFTLICCPGSDEKVFEVHVRPKKLAVEPKGSLEVNCSTTCNQPEVGGLETSLDKILLDEQAQWKHYLVSNISHDTVLQCHFTCSGKQESMNSNVSVYQPPRQVILTLQPTLVAVGKSFTIECRVPTVEPLDSLTLFLFRGNETLHYETFGKAAPAPQEATATFNSTADREDGHRNFSCLAVLDLMSRGGNIFHKHSAPKMLEIYEPVSDSQMVIIVTVVSVLLSLFVTSVLLCFIFGQHLRQQRMGTYGVRAAWRRLPQAFRP

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP0597-Ab Anti-ICAM2/ CD102 monoclonal antibody
    Target Antigen GM-Tg-g-MP0597-Ag ICAM2 VLP (virus-like particle)
    ORF Viral Vector pGMLP004573 Human ICAM2 Lentivirus plasmid
    ORF Viral Vector vGMLP004573 Human ICAM2 Lentivirus particle


    Target information

    Target ID GM-MP0597
    Target Name ICAM2
    Gene ID 3384, 15896, 574158, 360647, 101098907, 119873251, 100064400
    Gene Symbol and Synonyms CD102,Icam-2,ICAM2,Ly-60
    Uniprot Accession P13598
    Uniprot Entry Name ICAM2_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000108622
    Target Classification Not Available

    The protein encoded by this gene is a member of the intercellular adhesion molecule (ICAM) family. All ICAM proteins are type I transmembrane glycoproteins, contain 2-9 immunoglobulin-like C2-type domains, and bind to the leukocyte adhesion LFA-1 protein. This protein may play a role in lymphocyte recirculation by blocking LFA-1-dependent cell adhesion. It mediates adhesive interactions important for antigen-specific immune response, NK-cell mediated clearance, lymphocyte recirculation, and other cellular interactions important for immune response and surveillance. Several transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.