Human CCL18/AMAC-1/ AMAC1 ORF/cDNA clone-Lentivirus particle (NM_002988)

Pre-made Human CCL18/AMAC-1/ AMAC1 Lentiviral expression plasmid for CCL18 lentivirus packaging, CCL18 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to CCL18/AMAC-1 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP004613 Human CCL18 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP004613
Gene Name CCL18
Accession Number NM_002988
Gene ID 6362
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 270 bp
Gene Alias AMAC-1, AMAC1, CKb7, DC-CK1, DCCK1, MIP-4, PARC, SCYA18
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAAGGGCCTTGCAGCTGCCCTCCTTGTCCTCGTCTGCACCATGGCCCTCTGCTCCTGTGCACAAGTTGGTACCAACAAAGAGCTCTGCTGCCTCGTCTATACCTCCTGGCAGATTCCACAAAAGTTCATAGTTGACTATTCTGAAACCAGCCCCCAGTGCCCCAAGCCAGGTGTCATCCTCCTAACCAAGAGAGGCCGGCAGATCTGTGCTGACCCCAATAAGAAGTGGGTCCAGAAATACATCAGCGACCTGAAGCTGAATGCCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0743-Ab Anti-CCL18/ AMAC-1/ AMAC1 functional antibody
    Target Antigen GM-Tg-g-SE0743-Ag CCL18 protein
    Cytokine cks-Tg-g-GM-SE0743 chemokine (C-C motif) ligand 18 (pulmonary and activation-regulated) (CCL18) protein & antibody
    ORF Viral Vector pGMLP004613 Human CCL18 Lentivirus plasmid
    ORF Viral Vector vGMLP004613 Human CCL18 Lentivirus particle


    Target information

    Target ID GM-SE0743
    Target Name CCL18
    Gene ID 6362, 574181
    Gene Symbol and Synonyms AMAC-1,AMAC1,CCL18,CKb7,DC-CK1,DCCK1,MIP-4,PARC,SCYA18
    Uniprot Accession P55774
    Uniprot Entry Name CCL18_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Cytokine Target
    Disease Prostate Cancer, Malignant neoplasm of bladder, Overactive bladder
    Gene Ensembl ENSG00000275385
    Target Classification Not Available

    This antimicrobial gene is one of several Cys-Cys (CC) cytokine genes clustered on the q arm of chromosome 17. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The cytokine encoded by this gene displays chemotactic activity for naive T cells, CD4+ and CD8+ T cells and nonactivated lymphocytes, but not for monocytes or granulocytes. This chemokine attracts naive T lymphocytes toward dendritic cells and activated macrophages in lymph nodes. It may play a role in both humoral and cell-mediated immunity responses. [provided by RefSeq, Sep 2014]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.