Human CCL18/AMAC-1/ AMAC1 ORF/cDNA clone-Lentivirus particle (NM_002988)
Pre-made Human CCL18/AMAC-1/ AMAC1 Lentiviral expression plasmid for CCL18 lentivirus packaging, CCL18 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to CCL18/AMAC-1 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP004613 | Human CCL18 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP004613 |
Gene Name | CCL18 |
Accession Number | NM_002988 |
Gene ID | 6362 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 270 bp |
Gene Alias | AMAC-1, AMAC1, CKb7, DC-CK1, DCCK1, MIP-4, PARC, SCYA18 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAAGGGCCTTGCAGCTGCCCTCCTTGTCCTCGTCTGCACCATGGCCCTCTGCTCCTGTGCACAAGTTGGTACCAACAAAGAGCTCTGCTGCCTCGTCTATACCTCCTGGCAGATTCCACAAAAGTTCATAGTTGACTATTCTGAAACCAGCCCCCAGTGCCCCAAGCCAGGTGTCATCCTCCTAACCAAGAGAGGCCGGCAGATCTGTGCTGACCCCAATAAGAAGTGGGTCCAGAAATACATCAGCGACCTGAAGCTGAATGCCTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE0743-Ab | Anti-CCL18/ AMAC-1/ AMAC1 functional antibody |
Target Antigen | GM-Tg-g-SE0743-Ag | CCL18 protein |
Cytokine | cks-Tg-g-GM-SE0743 | chemokine (C-C motif) ligand 18 (pulmonary and activation-regulated) (CCL18) protein & antibody |
ORF Viral Vector | pGMLP004613 | Human CCL18 Lentivirus plasmid |
ORF Viral Vector | vGMLP004613 | Human CCL18 Lentivirus particle |
Target information
Target ID | GM-SE0743 |
Target Name | CCL18 |
Gene ID | 6362, 574181 |
Gene Symbol and Synonyms | AMAC-1,AMAC1,CCL18,CKb7,DC-CK1,DCCK1,MIP-4,PARC,SCYA18 |
Uniprot Accession | P55774 |
Uniprot Entry Name | CCL18_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Cytokine Target |
Disease | Prostate Cancer, Malignant neoplasm of bladder, Overactive bladder |
Gene Ensembl | ENSG00000275385 |
Target Classification | Not Available |
This antimicrobial gene is one of several Cys-Cys (CC) cytokine genes clustered on the q arm of chromosome 17. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The cytokine encoded by this gene displays chemotactic activity for naive T cells, CD4+ and CD8+ T cells and nonactivated lymphocytes, but not for monocytes or granulocytes. This chemokine attracts naive T lymphocytes toward dendritic cells and activated macrophages in lymph nodes. It may play a role in both humoral and cell-mediated immunity responses. [provided by RefSeq, Sep 2014]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.