Human AZU1/AZAMP/AZU ORF/cDNA clone-Lentivirus particle (NM_001700)

Cat. No.: vGMLP004614

Pre-made Human AZU1/AZAMP/AZU Lentiviral expression plasmid for AZU1 lentivirus packaging, AZU1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to AZU1/AZAMP products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP004614 Human AZU1 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP004614
Gene Name AZU1
Accession Number NM_001700
Gene ID 566
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 756 bp
Gene Alias AZAMP,AZU,CAP37,HBP,hHBP,HUMAZUR,NAZC
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGACCCGGCTGACAGTCCTGGCCCTGCTGGCTGGTCTGCTGGCGTCCTCGAGGGCCGGCTCCAGCCCCCTTTTGGACATCGTTGGCGGCCGGAAGGCGAGGCCCCGCCAGTTCCCGTTCCTGGCCTCCATTCAGAATCAAGGCAGGCACTTCTGCGGGGGTGCCCTGATCCATGCCCGCTTCGTGATGACCGCGGCCAGCTGCTTCCAAAGCCAGAACCCCGGGGTTAGCACCGTGGTGCTGGGTGCCTATGACCTGAGGCGGCGGGAGAGGCAGTCCCGCCAGACGTTTTCCATCAGCAGCATGAGCGAGAATGGCTACGACCCCCAGCAGAACCTGAACGACCTGATGCTGCTTCAGCTGGACCGTGAGGCCAACCTCACCAGCAGCGTGACGATACTGCCACTGCCTCTGCAGAACGCCACGGTGGAAGCCGGCACCAGATGCCAGGTGGCCGGCTGGGGGAGCCAGCGCAGTGGGGGGCGTCTCTCCCGTTTTCCCAGGTTTGTCAACGTGACTGTGACCCCCGAGGACCAGTGTCGCCCCAACAACGTGTGCACCGGTGTGCTCACCCGCCGCGGTGGCATCTGCAATGGGGACGGGGGCACCCCCCTCGTCTGCGAGGGCCTGGCCCACGGCGTGGCCTCCTTTTCCCTGGGGCCCTGTGGCCGAGGCCCTGACTTCTTCACCCGAGTGGCGCTCTTCCGAGACTGGATCGATGGTGTTCTCAACAACCCGGGACCGGGGCCAGCCTAG
ORF Protein Sequence MTRLTVLALLAGLLASSRAGSSPLLDIVGGRKARPRQFPFLASIQNQGRHFCGGALIHARFVMTAASCFQSQNPGVSTVVLGAYDLRRRERQSRQTFSISSMSENGYDPQQNLNDLMLLQLDREANLTSSVTILPLPLQNATVEAGTRCQVAGWGSQRSGGRLSRFPRFVNVTVTPEDQCRPNNVCTGVLTRRGGICNGDGGTPLVCEGLAHGVASFSLGPCGRGPDFFTRVALFRDWIDGVLNNPGPGPA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0682-Ab Anti-CAP7/ AZU1/ AZAMP functional antibody
    Target Antigen GM-Tg-g-SE0682-Ag AZU1 protein
    ORF Viral Vector pGMLP004614 Human AZU1 Lentivirus plasmid
    ORF Viral Vector vGMLP004614 Human AZU1 Lentivirus particle


    Target information

    Target ID GM-SE0682
    Target Name AZU1
    Gene ID 566, 100425740, 100336938, 100146319
    Gene Symbol and Synonyms AZAMP,AZU,AZU1,CAP37,HBP,hHBP,HUMAZUR,NAZC
    Uniprot Accession P20160
    Uniprot Entry Name CAP7_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Diagnostics Biomarker
    Disease Not Available
    Gene Ensembl ENSG00000172232
    Target Classification Not Available

    Azurophil granules, specialized lysosomes of the neutrophil, contain at least 10 proteins implicated in the killing of microorganisms. This gene encodes a preproprotein that is proteolytically processed to generate a mature azurophil granule antibiotic protein, with monocyte chemotactic and antimicrobial activity. It is also an important multifunctional inflammatory mediator. This encoded protein is a member of the serine protease gene family but it is not a serine proteinase, because the active site serine and histidine residues are replaced. The genes encoding this protein, neutrophil elastase 2, and proteinase 3 are in a cluster located at chromosome 19pter. All 3 genes are expressed coordinately and their protein products are packaged together into azurophil granules during neutrophil differentiation. [provided by RefSeq, Nov 2015]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.