Human AZU1/AZAMP/AZU ORF/cDNA clone-Lentivirus particle (NM_001700)
Cat. No.: vGMLP004614
Pre-made Human AZU1/AZAMP/AZU Lentiviral expression plasmid for AZU1 lentivirus packaging, AZU1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
AZU1/AZAMP products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP004614 | Human AZU1 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP004614 |
Gene Name | AZU1 |
Accession Number | NM_001700 |
Gene ID | 566 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 756 bp |
Gene Alias | AZAMP,AZU,CAP37,HBP,hHBP,HUMAZUR,NAZC |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGACCCGGCTGACAGTCCTGGCCCTGCTGGCTGGTCTGCTGGCGTCCTCGAGGGCCGGCTCCAGCCCCCTTTTGGACATCGTTGGCGGCCGGAAGGCGAGGCCCCGCCAGTTCCCGTTCCTGGCCTCCATTCAGAATCAAGGCAGGCACTTCTGCGGGGGTGCCCTGATCCATGCCCGCTTCGTGATGACCGCGGCCAGCTGCTTCCAAAGCCAGAACCCCGGGGTTAGCACCGTGGTGCTGGGTGCCTATGACCTGAGGCGGCGGGAGAGGCAGTCCCGCCAGACGTTTTCCATCAGCAGCATGAGCGAGAATGGCTACGACCCCCAGCAGAACCTGAACGACCTGATGCTGCTTCAGCTGGACCGTGAGGCCAACCTCACCAGCAGCGTGACGATACTGCCACTGCCTCTGCAGAACGCCACGGTGGAAGCCGGCACCAGATGCCAGGTGGCCGGCTGGGGGAGCCAGCGCAGTGGGGGGCGTCTCTCCCGTTTTCCCAGGTTTGTCAACGTGACTGTGACCCCCGAGGACCAGTGTCGCCCCAACAACGTGTGCACCGGTGTGCTCACCCGCCGCGGTGGCATCTGCAATGGGGACGGGGGCACCCCCCTCGTCTGCGAGGGCCTGGCCCACGGCGTGGCCTCCTTTTCCCTGGGGCCCTGTGGCCGAGGCCCTGACTTCTTCACCCGAGTGGCGCTCTTCCGAGACTGGATCGATGGTGTTCTCAACAACCCGGGACCGGGGCCAGCCTAG |
ORF Protein Sequence | MTRLTVLALLAGLLASSRAGSSPLLDIVGGRKARPRQFPFLASIQNQGRHFCGGALIHARFVMTAASCFQSQNPGVSTVVLGAYDLRRRERQSRQTFSISSMSENGYDPQQNLNDLMLLQLDREANLTSSVTILPLPLQNATVEAGTRCQVAGWGSQRSGGRLSRFPRFVNVTVTPEDQCRPNNVCTGVLTRRGGICNGDGGTPLVCEGLAHGVASFSLGPCGRGPDFFTRVALFRDWIDGVLNNPGPGPA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE0682-Ab | Anti-CAP7/ AZU1/ AZAMP functional antibody |
Target Antigen | GM-Tg-g-SE0682-Ag | AZU1 protein |
ORF Viral Vector | pGMLP004614 | Human AZU1 Lentivirus plasmid |
ORF Viral Vector | vGMLP004614 | Human AZU1 Lentivirus particle |
Target information
Target ID | GM-SE0682 |
Target Name | AZU1 |
Gene ID | 566, 100425740, 100336938, 100146319 |
Gene Symbol and Synonyms | AZAMP,AZU,AZU1,CAP37,HBP,hHBP,HUMAZUR,NAZC |
Uniprot Accession | P20160 |
Uniprot Entry Name | CAP7_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Diagnostics Biomarker |
Disease | Not Available |
Gene Ensembl | ENSG00000172232 |
Target Classification | Not Available |
Azurophil granules, specialized lysosomes of the neutrophil, contain at least 10 proteins implicated in the killing of microorganisms. This gene encodes a preproprotein that is proteolytically processed to generate a mature azurophil granule antibiotic protein, with monocyte chemotactic and antimicrobial activity. It is also an important multifunctional inflammatory mediator. This encoded protein is a member of the serine protease gene family but it is not a serine proteinase, because the active site serine and histidine residues are replaced. The genes encoding this protein, neutrophil elastase 2, and proteinase 3 are in a cluster located at chromosome 19pter. All 3 genes are expressed coordinately and their protein products are packaged together into azurophil granules during neutrophil differentiation. [provided by RefSeq, Nov 2015]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.