Human BST2/CD317/TETHERIN ORF/cDNA clone-Lentivirus particle (NM_004335)
Cat. No.: vGMLP004620
Pre-made Human BST2/CD317/TETHERIN Lentiviral expression plasmid for BST2 lentivirus packaging, BST2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
BST2/CD317 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP004620 | Human BST2 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP004620 |
Gene Name | BST2 |
Accession Number | NM_004335 |
Gene ID | 684 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 543 bp |
Gene Alias | CD317,TETHERIN |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGGCATCTACTTCGTATGACTATTGCAGAGTGCCCATGGAAGACGGGGATAAGCGCTGTAAGCTTCTGCTGGGGATAGGAATTCTGGTGCTCCTGATCATCGTGATTCTGGGGGTGCCCTTGATTATCTTCACCATCAAGGCCAACAGCGAGGCCTGCCGGGACGGCCTTCGGGCAGTGATGGAGTGTCGCAATGTCACCCATCTCCTGCAACAAGAGCTGACCGAGGCCCAGAAGGGCTTTCAGGATGTGGAGGCCCAGGCCGCCACCTGCAACCACACTGTGATGGCCCTAATGGCTTCCCTGGATGCAGAGAAGGCCCAAGGACAAAAGAAAGTGGAGGAGCTTGAGGGAGAGATCACTACATTAAACCATAAGCTTCAGGACGCGTCTGCAGAGGTGGAGCGACTGAGAAGAGAAAACCAGGTCTTAAGCGTGAGAATCGCGGACAAGAAGTACTACCCCAGCTCCCAGGACTCCAGCTCCGCTGCGGCGCCCCAGCTGCTGATTGTGCTGCTGGGCCTCAGCGCTCTGCTGCAGTGA |
ORF Protein Sequence | MASTSYDYCRVPMEDGDKRCKLLLGIGILVLLIIVILGVPLIIFTIKANSEACRDGLRAVMECRNVTHLLQQELTEAQKGFQDVEAQAATCNHTVMALMASLDAEKAQGQKKVEELEGEITTLNHKLQDASAEVERLRRENQVLSVRIADKKYYPSSQDSSSAAAPQLLIVLLGLSALLQ |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T77745-Ab | Anti-BST2/ CD317/ TETHERIN monoclonal antibody |
Target Antigen | GM-Tg-g-T77745-Ag | BST2 VLP (virus-like particle) |
ORF Viral Vector | pGMLP004620 | Human BST2 Lentivirus plasmid |
ORF Viral Vector | vGMLP004620 | Human BST2 Lentivirus particle |
Target information
Target ID | GM-T77745 |
Target Name | BST2 |
Gene ID | 684, 69550, 719092, 378947, 100652388, 609654, 100146856 |
Gene Symbol and Synonyms | 2310015I10Rik,Bst-2,BST2,BST2.1,BST2.10,BST2.11,BST2.12,BST2.13,BST2.14,BST2.15,BST2.3,BST2.4,BST2.5,BST2.6,BST2.7,BST2.9,CD317,DAMP-1,Damp1,GREG,HM1.24,TETHERIN |
Uniprot Accession | Q10589 |
Uniprot Entry Name | BST2_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000130303 |
Target Classification | Not Available |
Bone marrow stromal cells are involved in the growth and development of B-cells. The specific function of the protein encoded by the bone marrow stromal cell antigen 2 is undetermined; however, this protein may play a role in pre-B-cell growth and in rheumatoid arthritis. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.