Human BST2/CD317/TETHERIN ORF/cDNA clone-Lentivirus particle (NM_004335)

Cat. No.: vGMLP004620

Pre-made Human BST2/CD317/TETHERIN Lentiviral expression plasmid for BST2 lentivirus packaging, BST2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to BST2/CD317 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP004620 Human BST2 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP004620
Gene Name BST2
Accession Number NM_004335
Gene ID 684
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 543 bp
Gene Alias CD317,TETHERIN
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCATCTACTTCGTATGACTATTGCAGAGTGCCCATGGAAGACGGGGATAAGCGCTGTAAGCTTCTGCTGGGGATAGGAATTCTGGTGCTCCTGATCATCGTGATTCTGGGGGTGCCCTTGATTATCTTCACCATCAAGGCCAACAGCGAGGCCTGCCGGGACGGCCTTCGGGCAGTGATGGAGTGTCGCAATGTCACCCATCTCCTGCAACAAGAGCTGACCGAGGCCCAGAAGGGCTTTCAGGATGTGGAGGCCCAGGCCGCCACCTGCAACCACACTGTGATGGCCCTAATGGCTTCCCTGGATGCAGAGAAGGCCCAAGGACAAAAGAAAGTGGAGGAGCTTGAGGGAGAGATCACTACATTAAACCATAAGCTTCAGGACGCGTCTGCAGAGGTGGAGCGACTGAGAAGAGAAAACCAGGTCTTAAGCGTGAGAATCGCGGACAAGAAGTACTACCCCAGCTCCCAGGACTCCAGCTCCGCTGCGGCGCCCCAGCTGCTGATTGTGCTGCTGGGCCTCAGCGCTCTGCTGCAGTGA
ORF Protein Sequence MASTSYDYCRVPMEDGDKRCKLLLGIGILVLLIIVILGVPLIIFTIKANSEACRDGLRAVMECRNVTHLLQQELTEAQKGFQDVEAQAATCNHTVMALMASLDAEKAQGQKKVEELEGEITTLNHKLQDASAEVERLRRENQVLSVRIADKKYYPSSQDSSSAAAPQLLIVLLGLSALLQ

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T77745-Ab Anti-BST2/ CD317/ TETHERIN monoclonal antibody
    Target Antigen GM-Tg-g-T77745-Ag BST2 VLP (virus-like particle)
    ORF Viral Vector pGMLP004620 Human BST2 Lentivirus plasmid
    ORF Viral Vector vGMLP004620 Human BST2 Lentivirus particle


    Target information

    Target ID GM-T77745
    Target Name BST2
    Gene ID 684, 69550, 719092, 378947, 100652388, 609654, 100146856
    Gene Symbol and Synonyms 2310015I10Rik,Bst-2,BST2,BST2.1,BST2.10,BST2.11,BST2.12,BST2.13,BST2.14,BST2.15,BST2.3,BST2.4,BST2.5,BST2.6,BST2.7,BST2.9,CD317,DAMP-1,Damp1,GREG,HM1.24,TETHERIN
    Uniprot Accession Q10589
    Uniprot Entry Name BST2_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000130303
    Target Classification Not Available

    Bone marrow stromal cells are involved in the growth and development of B-cells. The specific function of the protein encoded by the bone marrow stromal cell antigen 2 is undetermined; however, this protein may play a role in pre-B-cell growth and in rheumatoid arthritis. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.