Human TMEM65 ORF/cDNA clone-Lentivirus particle (NM_194291)

Cat. No.: vGMLP004654

Pre-made Human TMEM65/ Lentiviral expression plasmid for TMEM65 lentivirus packaging, TMEM65 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to TMEM65/ products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP004654 Human TMEM65 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP004654
Gene Name TMEM65
Accession Number NM_194291
Gene ID 157378
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 723 bp
Gene Alias
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGTCCCGGCTGCTGCCGCTGCTGAGGAGCCGGACCGCGCGCAGCCTGAGGCCGGGCCCGGCCGCCGCCGCCGCGCCCCGCCCGCCGTCCTGGTGCTGCTGCGGGCGGGGGCTGCTGGCGCTCGCGCCCCCCGGCGGCTTGCCGGGCGGCCCCAGGCGGCTGGGCACGCACCCCAAGAAGGAGCCCATGGAGGCGCTGAACACGGCGCAGGGCGCGCGCGACTTCATCTACAGCCTGCACTCCACGGAGAGGAGCTGCCTGCTCAAAGAGCTGCACCGCTTCGAGTCTATTGCCATTGCCCAAGAAAAATTGGAAGCTCCACCACCCACCCCAGGACAGCTGAGATATGTATTCATCCACAATGCGATACCTTTCATAGGGTTTGGCTTTTTGGATAATGCAATTATGATTGTTGCTGGAACCCATATTGAAATGTCTATTGGAATTATTTTGGGAATTTCAACTATGGCAGCTGCTGCTTTGGGAAATCTTGTGTCAGATCTAGCTGGACTTGGACTTGCAGGCTACGTTGAAGCATTGGCTTCCAGGTTAGGCCTGTCAATTCCTGATCTCACACCAAAGCAAGTTGACATGTGGCAAACACGTCTTAGTACACATTTGGGCAAAGCTGTTGGGGTGACTATTGGCTGCATTCTAGGAATGTTTCCTTTAATTTTCTTTGGAGGAGGTGAAGAAGATGAAAAACTGGAAACGAAAAGTTAA
ORF Protein Sequence MSRLLPLLRSRTARSLRPGPAAAAAPRPPSWCCCGRGLLALAPPGGLPGGPRRLGTHPKKEPMEALNTAQGARDFIYSLHSTERSCLLKELHRFESIAIAQEKLEAPPPTPGQLRYVFIHNAIPFIGFGFLDNAIMIVAGTHIEMSIGIILGISTMAAAALGNLVSDLAGLGLAGYVEALASRLGLSIPDLTPKQVDMWQTRLSTHLGKAVGVTIGCILGMFPLIFFGGGEEDEKLETKS

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP1840-Ab Anti-TMM65/ TMEM65 monoclonal antibody
    Target Antigen GM-Tg-g-MP1840-Ag TMEM65 VLP (virus-like particle)
    ORF Viral Vector pGMLP004654 Human TMEM65 Lentivirus plasmid
    ORF Viral Vector vGMLP004654 Human TMEM65 Lentivirus particle


    Target information

    Target ID GM-MP1840
    Target Name TMEM65
    Gene ID 157378, 74868, 705727, 500874, 101090234, 609394, 614243, 100629528
    Gene Symbol and Synonyms 2610029O13Rik,4930438D12Rik,RGD1563224,TMEM65
    Uniprot Accession Q6PI78
    Uniprot Entry Name TMM65_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000164983
    Target Classification Not Available

    Predicted to be involved in cardiac ventricle development and regulation of cardiac conduction. Located in intercalated disc; mitochondrial inner membrane; and plasma membrane. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.