Human PGRMC1/Dap1/ HPR6.6 ORF/cDNA clone-Lentivirus particle (NM_006667)

Pre-made Human PGRMC1/Dap1/ HPR6.6 Lentiviral expression plasmid for PGRMC1 lentivirus packaging, PGRMC1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to PGRMC1/Dap1 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP004673 Human PGRMC1 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP004673
Gene Name PGRMC1
Accession Number NM_006667
Gene ID 10857
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 588 bp
Gene Alias Dap1, HPR6.6, IZA, MPR
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCTGCCGAGGATGTGGTGGCGACTGGCGCCGACCCAAGCGATCTGGAGAGCGGCGGGCTGCTGCATGAGATTTTCACGTCGCCGCTCAACCTGCTGCTGCTTGGCCTCTGCATCTTCCTGCTCTACAAGATCGTGCGCGGGGACCAGCCGGCGGCCAGCGGCGACAGCGACGACGACGAGCCGCCCCCTCTGCCCCGCCTCAAGCGGCGCGACTTCACCCCCGCCGAGCTGCGGCGCTTCGACGGCGTCCAGGACCCGCGCATACTCATGGCCATCAACGGCAAGGTGTTCGATGTGACCAAAGGCCGCAAATTCTACGGGCCCGAGGGGCCGTATGGGGTCTTTGCTGGAAGAGATGCATCCAGGGGCCTTGCCACATTTTGCCTGGATAAGGAAGCACTGAAGGATGAGTACGATGACCTTTCTGACCTCACTGCTGCCCAGCAGGAGACTCTGAGTGACTGGGAGTCTCAGTTCACTTTCAAGTATCATCACGTGGGCAAACTGCTGAAGGAGGGGGAGGAGCCCACTGTGTACTCAGATGAGGAAGAACCAAAAGATGAGAGTGCCCGGAAAAATGATTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T17814-Ab Anti-PGRC1/ PGRMC1/ Dap1 monoclonal antibody
    Target Antigen GM-Tg-g-T17814-Ag PGRMC1 VLP (virus-like particle)
    ORF Viral Vector pGMLV001634 Rat Pgrmc1 Lentivirus plasmid
    ORF Viral Vector pGMAAV000311 Rat Pgrmc1 Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMLP004673 Human PGRMC1 Lentivirus plasmid
    ORF Viral Vector vGMLV001634 Rat Pgrmc1 Lentivirus particle
    ORF Viral Vector vGMAAV000311 Rat Pgrmc1 Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMLP004673 Human PGRMC1 Lentivirus particle


    Target information

    Target ID GM-T17814
    Target Name PGRMC1
    Gene ID 10857, 53328, 711792, 291948, 105260228, 481029, 317706, 100058718
    Gene Symbol and Synonyms 25-Dx,25Dx,Dap1,HPR6.6,IZA,MPR,PGRMC1,PPMR,Vema
    Uniprot Accession O00264
    Uniprot Entry Name PGRC1_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000101856
    Target Classification Not Available

    This gene encodes a putative membrane-associated progesterone steroid receptor. The protein is expressed predominantly in the liver and kidney. [provided by RefSeq, Mar 2010]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.