Human RNASE3/ECP/ RAF1 ORF/cDNA clone-Lentivirus particle (NM_002935)

Pre-made Human RNASE3/ECP/ RAF1 Lentiviral expression plasmid for RNASE3 lentivirus packaging, RNASE3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to RNASE3/ECP products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP004675 Human RNASE3 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP004675
Gene Name RNASE3
Accession Number NM_002935
Gene ID 6037
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 483 bp
Gene Alias ECP, RAF1, RNS3
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGTTCCAAAACTGTTCACTTCCCAAATTTGTCTGCTTCTTCTGTTGGGGCTTATGGGTGTGGAGGGCTCACTCCATGCCAGACCCCCACAGTTTACGAGGGCTCAGTGGTTTGCCATCCAGCACATCAGTCTGAACCCCCCTCGATGCACCATTGCAATGCGGGCAATTAACAATTATCGATGGCGTTGCAAAAACCAAAATACTTTTCTTCGTACAACTTTTGCTAATGTAGTTAATGTTTGTGGTAACCAAAGTATACGCTGCCCTCATAACAGAACTCTCAACAATTGTCATCGGAGTAGATTCCGGGTGCCTTTACTCCACTGTGACCTCATAAATCCAGGTGCACAGAATATTTCAAACTGCACGTATGCAGACAGACCAGGAAGGAGGTTCTATGTAGTTGCATGTGACAACAGAGATCCACGGGATTCTCCACGGTATCCTGTGGTTCCAGTTCACCTGGATACCACCATCTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1248-Ab Anti-ECP/ RNASE3/ RAF1 functional antibody
    Target Antigen GM-Tg-g-SE1248-Ag RNASE3 protein
    ORF Viral Vector pGMLP004675 Human RNASE3 Lentivirus plasmid
    ORF Viral Vector vGMLP004675 Human RNASE3 Lentivirus particle


    Target information

    Target ID GM-SE1248
    Target Name RNASE3
    Gene ID 6037
    Gene Symbol and Synonyms ECP,RAF1,RNASE3,RNS3
    Uniprot Accession P12724
    Uniprot Entry Name ECP_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000169397
    Target Classification Not Available

    The protein encoded by this gene belongs to the pancreatic ribonuclease family, a subset of the ribonuclease A superfamily. The protein exhibits antimicrobial activity against pathogenic bacteria [provided by RefSeq, Oct 2014]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.