Human SDHAF4/C6orf57/ Sdh8 ORF/cDNA clone-Lentivirus particle (NM_145267)
Pre-made Human SDHAF4/C6orf57/ Sdh8 Lentiviral expression plasmid for SDHAF4 lentivirus packaging, SDHAF4 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to SDHAF4/C6orf57 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP004692 | Human SDHAF4 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP004692 |
Gene Name | SDHAF4 |
Accession Number | NM_145267 |
Gene ID | 135154 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 327 bp |
Gene Alias | C6orf57, Sdh8 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGACCCCATCGAGGCTTCCCTGGTTGCTTAGCTGGGTCTCGGCCACGGCGTGGAGAGCGGCAAGATCACCCCTTCTGTGTCATTCTCTGAGGAAAACAAGTTCTTCTCAAGGAGGAAAGTCTGAACTTGTCAAACAGTCCCTTAAGAAGCCGAAGTTACCAGAAGGTCGTTTTGATGCACCAGAGGATTCCCATTTAGAGAAAGAACCACTGGAAAAATTTCCAGATGATGTTAATCCAGTGACCAAAGAAAAAGGTGGACCCAGGGGCCCAGAACCTACCCGATATGGAGATTGGGAACGAAAAGGACGCTGTATTGATTTTTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE1539-Ab | Anti-SDHF4/ SDHAF4/ C6orf57 functional antibody |
Target Antigen | GM-Tg-g-SE1539-Ag | SDHAF4 protein |
ORF Viral Vector | pGMLP004692 | Human SDHAF4 Lentivirus plasmid |
ORF Viral Vector | vGMLP004692 | Human SDHAF4 Lentivirus particle |
Target information
Target ID | GM-SE1539 |
Target Name | SDHAF4 |
Gene ID | 135154, 68002, 717008, 685888, 101089864, 610894, 768071, 100629833 |
Gene Symbol and Synonyms | 1110058L19Rik,1700001E18Rik,C12H6orf57,C4H6orf57,C6orf57,C9H6orf57,Sdh8,SDHAF4 |
Uniprot Accession | Q5VUM1 |
Uniprot Entry Name | SDHF4_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000154079 |
Target Classification | Not Available |
Predicted to enable enzyme activator activity. Involved in cellular respiration and mitochondrial respiratory chain complex II assembly. Predicted to be located in mitochondrial matrix. Predicted to be active in mitochondrion. [provided by Alliance of Genome Resources, Apr 2022]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.