Human GCA/GCL ORF/cDNA clone-Lentivirus particle (NM_001330265)

Cat. No.: vGMLP004796

Pre-made Human GCA/GCL Lentiviral expression plasmid for GCA lentivirus packaging, GCA lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to GCA/GCL products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP004796 Human GCA Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP004796
Gene Name GCA
Accession Number NM_001330265
Gene ID 25801
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 699 bp
Gene Alias GCL
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGTGGATGGACTTGAACCACCAACTCAGCTTAGAAGGAAGCCAAGACTTAAAGTTTCCTAGATCCCAGCTTTTTGGAAATTTTAGCATTCAGGTGCCAGGAATGCAGATGGGACAGCCAGTGCCAGAAACAGGCCCAGCTATACTCCTCGATGGATACTCTGGGCCAGCATATTCAGACACTTATTCCTCAGCTGGTGACTCCGTGTATACTTACTTCAGTGCTGTTGCTGGACAGGATGGTGAAGTGGATGCTGAAGAACTTCAGAGATGTTTGACACAGTCTGGAATTAATGGAACTTACTCTCCCTTCAGTTTGGAAACCTGCAGAATTATGATTGCCATGTTGGATAGAGATCACACAGGAAAAATGGGATTTAATGCATTCAAAGAGCTATGGGCAGCTCTTAATGCCTGGAAGGAAAACTTCATGACTGTTGATCAAGATGGAAGTGGCACAGTAGAACATCATGAGTTGCGTCAAGCCATTGGTCTTATGGGTTATAGGTTGAGTCCTCAAACATTAACTACTATTGTTAAACGTTATAGCAAGAATGGCAGAATTTTCTTTGATGATTATGTTGCTTGCTGTGTGAAGCTTCGAGCATTGACAGATTTCTTTAGGAAAAGAGACCACTTGCAACAAGGGTCTGCGAATTTCATATATGACGATTTTTTGCAGGGCACTATGGCAATTTGA
ORF Protein Sequence MWMDLNHQLSLEGSQDLKFPRSQLFGNFSIQVPGMQMGQPVPETGPAILLDGYSGPAYSDTYSSAGDSVYTYFSAVAGQDGEVDAEELQRCLTQSGINGTYSPFSLETCRIMIAMLDRDHTGKMGFNAFKELWAALNAWKENFMTVDQDGSGTVEHHELRQAIGLMGYRLSPQTLTTIVKRYSKNGRIFFDDYVACCVKLRALTDFFRKRDHLQQGSANFIYDDFLQGTMAI

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP2140-Ab Anti-GRAN/ GCA/ GCL monoclonal antibody
    Target Antigen GM-Tg-g-MP2140-Ag GCA VLP (virus-like particle)
    ORF Viral Vector pGMLP004796 Human GCA Lentivirus plasmid
    ORF Viral Vector vGMLP004796 Human GCA Lentivirus particle


    Target information

    Target ID GM-MP2140
    Target Name GCA
    Gene ID 25801, 227960, 702138, 295647, 101098073, 608208, 507139, 100051621
    Gene Symbol and Synonyms 5133401E04Rik,GCA,GCL
    Uniprot Accession P28676
    Uniprot Entry Name GRAN_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000115271
    Target Classification Not Available

    This gene encodes a calcium-binding protein that is abundant in neutrophils and macrophages. In the absence of divalent cation, this protein localizes to the cytosolic fraction; with magnesium alone, it partitions with the granule fraction; and in the presence of magnesium and calcium, it associates with both the granule and membrane fractions. Alternative splicing and use of alternative promoters results in multiple transcript variants. [provided by RefSeq, Aug 2016]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.