Human GCA/GCL ORF/cDNA clone-Lentivirus particle (NM_001330265)
Cat. No.: vGMLP004796
Pre-made Human GCA/GCL Lentiviral expression plasmid for GCA lentivirus packaging, GCA lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
GCA/GCL products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
| Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
|---|---|---|---|
| vGMLP004796 | Human GCA Lentivirus particle | Pilot Grade | 1.0E+8TU |
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| Research Grade | 1.0E+8TU | ||
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMLP004796 |
| Gene Name | GCA |
| Accession Number | NM_001330265 |
| Gene ID | 25801 |
| Species | Human |
| Product Type | Lentivirus particle (overexpression) |
| Insert Length | 699 bp |
| Gene Alias | GCL |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGTGGATGGACTTGAACCACCAACTCAGCTTAGAAGGAAGCCAAGACTTAAAGTTTCCTAGATCCCAGCTTTTTGGAAATTTTAGCATTCAGGTGCCAGGAATGCAGATGGGACAGCCAGTGCCAGAAACAGGCCCAGCTATACTCCTCGATGGATACTCTGGGCCAGCATATTCAGACACTTATTCCTCAGCTGGTGACTCCGTGTATACTTACTTCAGTGCTGTTGCTGGACAGGATGGTGAAGTGGATGCTGAAGAACTTCAGAGATGTTTGACACAGTCTGGAATTAATGGAACTTACTCTCCCTTCAGTTTGGAAACCTGCAGAATTATGATTGCCATGTTGGATAGAGATCACACAGGAAAAATGGGATTTAATGCATTCAAAGAGCTATGGGCAGCTCTTAATGCCTGGAAGGAAAACTTCATGACTGTTGATCAAGATGGAAGTGGCACAGTAGAACATCATGAGTTGCGTCAAGCCATTGGTCTTATGGGTTATAGGTTGAGTCCTCAAACATTAACTACTATTGTTAAACGTTATAGCAAGAATGGCAGAATTTTCTTTGATGATTATGTTGCTTGCTGTGTGAAGCTTCGAGCATTGACAGATTTCTTTAGGAAAAGAGACCACTTGCAACAAGGGTCTGCGAATTTCATATATGACGATTTTTTGCAGGGCACTATGGCAATTTGA |
| ORF Protein Sequence | MWMDLNHQLSLEGSQDLKFPRSQLFGNFSIQVPGMQMGQPVPETGPAILLDGYSGPAYSDTYSSAGDSVYTYFSAVAGQDGEVDAEELQRCLTQSGINGTYSPFSLETCRIMIAMLDRDHTGKMGFNAFKELWAALNAWKENFMTVDQDGSGTVEHHELRQAIGLMGYRLSPQTLTTIVKRYSKNGRIFFDDYVACCVKLRALTDFFRKRDHLQQGSANFIYDDFLQGTMAI |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-MP2140-Ab | Anti-GRAN/ GCA/ GCL monoclonal antibody |
| Target Antigen | GM-Tg-g-MP2140-Ag | GCA VLP (virus-like particle) |
| ORF Viral Vector | pGMLP004796 | Human GCA Lentivirus plasmid |
| ORF Viral Vector | vGMLP004796 | Human GCA Lentivirus particle |
Target information
| Target ID | GM-MP2140 |
| Target Name | GCA |
| Gene ID | 25801, 227960, 702138, 295647, 101098073, 608208, 507139, 100051621 |
| Gene Symbol and Synonyms | 5133401E04Rik,GCA,GCL |
| Uniprot Accession | P28676 |
| Uniprot Entry Name | GRAN_HUMAN |
| Protein Sub-location | Transmembrane Protein |
| Category | Not Available |
| Disease | Not Available |
| Gene Ensembl | ENSG00000115271 |
| Target Classification | Not Available |
This gene encodes a calcium-binding protein that is abundant in neutrophils and macrophages. In the absence of divalent cation, this protein localizes to the cytosolic fraction; with magnesium alone, it partitions with the granule fraction; and in the presence of magnesium and calcium, it associates with both the granule and membrane fractions. Alternative splicing and use of alternative promoters results in multiple transcript variants. [provided by RefSeq, Aug 2016]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


