Human Rgr/RP44 ORF/cDNA clone-Lentivirus particle (NM_002921)

Cat. No.: vGMLP004932

Pre-made Human Rgr/RP44 Lentiviral expression plasmid for Rgr lentivirus packaging, Rgr lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to RGR/Rgr/RP44 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP004932 Human Rgr Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP004932
Gene Name Rgr
Accession Number NM_002921
Gene ID 5995
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 888 bp
Gene Alias RP44
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCAGAGACCAGTGCCCTGCCCACTGGCTTCGGGGAGCTCGAGGTGCTGGCTGTGGGGATGGTGCTACTGGTGGAAGCTCTCTCCGGTCTCAGCCTCAATACCCTGACCATCTTCTCTTTCTGCAAGACCCCGGAGCTGCGGACTCCCTGCCACCTACTGGTGCTGAGCTTGGCTCTTGCGGACAGTGGGATCAGCCTGAATGCCCTCGTTGCAGCCACATCCAGCCTTCTCCGTGTCTCCCACAGGCGCTGGCCCTACGGCTCGGACGGCTGCCAGGCTCACGGCTTCCAGGGCTTTGTGACAGCGTTGGCCAGCATCTGCAGCAGTGCAGCCATCGCATGGGGGCGTTATCACCACTACTGCACCCGTAGCCAGCTGGCCTGGAACTCAGCCGTCTCTCTGGTGCTCTTCGTGTGGCTGTCTTCTGCCTTCTGGGCAGCTCTGCCCCTTCTGGGTTGGGGTCACTACGACTATGAGCCACTGGGGACATGCTGCACCCTGGACTACTCCAAGGGGGACAGAAACTTCACCAGCTTCCTCTTCACCATGTCCTTCTTCAACTTCGCCATGCCCCTCTTCATCACGATCACTTCCTACAGTCTCATGGAGCAGAAACTGGGGAAGAGTGGCCATCTCCAGGTAAACACCACTCTGCCAGCAAGGACGCTGCTGCTCGGCTGGGGCCCCTATGCCATCCTGTATCTATACGCAGTCATCGCAGACGTGACTTCCATCTCCCCCAAACTGCAGATGGTGCCCGCCCTCATTGCCAAAATGGTGCCCACGATCAATGCCATCAACTATGCCCTGGGCAATGAGATGGTCTGCAGGGGAATCTGGCAGTGCCTCTCACCGCAGAAGAGGGAGAAGGACCGAACCAAGTGA
ORF Protein Sequence MAETSALPTGFGELEVLAVGMVLLVEALSGLSLNTLTIFSFCKTPELRTPCHLLVLSLALADSGISLNALVAATSSLLRVSHRRWPYGSDGCQAHGFQGFVTALASICSSAAIAWGRYHHYCTRSQLAWNSAVSLVLFVWLSSAFWAALPLLGWGHYDYEPLGTCCTLDYSKGDRNFTSFLFTMSFFNFAMPLFITITSYSLMEQKLGKSGHLQVNTTLPARTLLLGWGPYAILYLYAVIADVTSISPKLQMVPALIAKMVPTINAINYALGNEMVCRGIWQCLSPQKREKDRTK

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP1486-Ab Anti-RGR monoclonal antibody
    Target Antigen GM-Tg-g-IP1486-Ag RGR protein
    ORF Viral Vector pGMLP004932 Human Rgr Lentivirus plasmid
    ORF Viral Vector vGMLP004932 Human Rgr Lentivirus particle


    Target information

    Target ID GM-IP1486
    Target Name RGR
    Gene ID 5995, 57811, 698258, 306307, 101083036, 489072, 280911, 100065091
    Gene Symbol and Synonyms RGR,RP44
    Uniprot Accession P47804
    Uniprot Entry Name RGR_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000148604
    Target Classification Not Available

    This gene encodes a putative retinal G-protein coupled receptor. The gene is a member of the opsin subfamily of the 7 transmembrane, G-protein coupled receptor 1 family. Like other opsins which bind retinaldehyde, it contains a conserved lysine residue in the seventh transmembrane domain. The protein acts as a photoisomerase to catalyze the conversion of all-trans-retinal to 11-cis-retinal. The reverse isomerization occurs with rhodopsin in retinal photoreceptor cells. The protein is exclusively expressed in tissue adjacent to retinal photoreceptor cells, the retinal pigment epithelium and Mueller cells. This gene may be associated with autosomal recessive and autosomal dominant retinitis pigmentosa (arRP and adRP, respectively). Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.