Human PYY/PYY-I/PYY1 ORF/cDNA clone-Lentivirus particle (NM_004160)
Cat. No.: vGMLP004964
Pre-made Human PYY/PYY-I/PYY1 Lentiviral expression plasmid for PYY lentivirus packaging, PYY lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
PYY/PYY-I products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
| Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
|---|---|---|---|
| vGMLP004964 | Human PYY Lentivirus particle | Pilot Grade | 1.0E+8TU |
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| Research Grade | 1.0E+8TU | ||
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMLP004964 |
| Gene Name | PYY |
| Accession Number | NM_004160 |
| Gene ID | 5697 |
| Species | Human |
| Product Type | Lentivirus particle (overexpression) |
| Insert Length | 294 bp |
| Gene Alias | PYY-I,PYY1 |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGGTGTTCGTGCGCAGGCCGTGGCCCGCCTTGACCACAGTGCTTCTGGCCCTGCTCGTCTGCCTAGGGGCGCTGGTCGACGCCTACCCCATCAAACCCGAGGCTCCCCGCGAAGACGCCTCGCCGGAGGAGCTGAACCGCTACTACGCCTCCCTGCGCCACTACCTCAACCTGGTCACCCGGCAGCGGTATGGGAAAAGAGACGGCCCGGACACGCTTCTTTCCAAAACGTTCTTCCCCGACGGCGAGGACCGCCCCGTCAGGTCGCGGTCGGAGGGCCCAGACCTGTGGTGA |
| ORF Protein Sequence | MVFVRRPWPALTTVLLALLVCLGALVDAYPIKPEAPREDASPEELNRYYASLRHYLNLVTRQRYGKRDGPDTLLSKTFFPDGEDRPVRSRSEGPDLW |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-T24127-Ab | Anti-PYY/ PYY-I1 functional antibody |
| Target Antigen | GM-Tg-g-T24127-Ag | PYY protein |
| ORF Viral Vector | pGMLP004964 | Human PYY Lentivirus plasmid |
| ORF Viral Vector | vGMLP004964 | Human PYY Lentivirus particle |
Target information
| Target ID | GM-T24127 |
| Target Name | PYY |
| Gene ID | 5697, 217212, 714041, 287730, 105261189, 607156, 100051539 |
| Gene Symbol and Synonyms | GHYY,peptide-YY,PYY,PYY-I,PYY1,RATGHYY,Yy |
| Uniprot Accession | P10082 |
| Uniprot Entry Name | PYY_HUMAN |
| Protein Sub-location | Secreted Protein/Potential Cytokines |
| Category | Therapeutics Target |
| Disease | Not Available |
| Gene Ensembl | ENSG00000131096 |
| Target Classification | Not Available |
This gene encodes a member of the neuropeptide Y (NPY) family of peptides. The encoded preproprotein is proteolytically processed to generate two alternative peptide products that differ in length by three amino acids. These peptides, secreted by endocrine cells in the gut, exhibit different binding affinities for each of the neuropeptide Y receptors. Binding of the encoded peptides to these receptors mediates regulation of pancreatic secretion, gut mobility and energy homeostasis. Rare variations in this gene could increase susceptibility to obesity and elevated serum levels of the encoded peptides may be associated with anorexia nervosa. [provided by RefSeq, Feb 2016]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


