Human SCT ORF/cDNA clone-Lentivirus particle (NM_021920)
Pre-made Human SCT/ Lentiviral expression plasmid for SCT lentivirus packaging, SCT lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to SCT/ products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP004971 | Human SCT Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP004971 |
Gene Name | SCT |
Accession Number | NM_021920 |
Gene ID | 6343 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 366 bp |
Gene Alias | |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGCCCCCCGGCCCCTCCTGCTGCTGCTGCTGCTCCTCGGGGGCTCCGCCGCGCGCCCCGCGCCCCCCAGGGCCCGGCGACACTCAGACGGGACGTTCACCAGCGAGCTCAGCCGCCTGCGGGAGGGCGCGCGGCTCCAGCGGCTGCTACAGGGCCTGGTGGGGAAGCGCAGCGAGCAGGACGCAGAGAACAGCATGGCCTGGACCAGGCTCAGCGCGGGTCTGCTCTGCCCGTCAGGGTCCAACATGCCCATCCTGCAGGCCTGGATGCCCCTGGACGGGACCTGGTCTCCCTGGCTGCCCCCTGGGCCTATGGTTTCAGAACCAGCTGGCGCTGCTGCAGAAGGAACCTTGCGGCCCAGATGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T46904-Ab | Anti-SECR/ SCT functional antibody |
Target Antigen | GM-Tg-g-T46904-Ag | SCT protein |
ORF Viral Vector | pGMLP004971 | Human SCT Lentivirus plasmid |
ORF Viral Vector | vGMLP004971 | Human SCT Lentivirus particle |
Target information
Target ID | GM-T46904 |
Target Name | SCT |
Gene ID | 6343, 20287, 114672195, 24769, 109492260, 119864200, 104976311, 100630455 |
Gene Symbol and Synonyms | SCT,Secr |
Uniprot Accession | P09683 |
Uniprot Entry Name | SECR_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000070031 |
Target Classification | Not Available |
This gene encodes a member of the glucagon family of peptides. The encoded preproprotein is secreted by endocrine S cells in the proximal small intestinal mucosa as a prohormone, then proteolytically processed to generate the mature peptide hormone. The release of this active peptide hormone is stimulated by either fatty acids or acidic pH in the duodenum. This hormone stimulates the secretion of bile and bicarbonate in the duodenum, pancreatic and biliary ducts. [provided by RefSeq, Feb 2016]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.