Human UPK3A/UP3A/UPIII ORF/cDNA clone-Lentivirus particle (NM_006953)
Cat. No.: vGMLP004984
Pre-made Human UPK3A/UP3A/UPIII Lentiviral expression plasmid for UPK3A lentivirus packaging, UPK3A lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
UPK3A/UP3A products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
| Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
|---|---|---|---|
| vGMLP004984 | Human UPK3A Lentivirus particle | Pilot Grade | 1.0E+8TU |
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| Research Grade | 1.0E+8TU | ||
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMLP004984 |
| Gene Name | UPK3A |
| Accession Number | NM_006953 |
| Gene ID | 7380 |
| Species | Human |
| Product Type | Lentivirus particle (overexpression) |
| Insert Length | 864 bp |
| Gene Alias | UP3A,UPIII,UPIIIA,UPK3 |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGCCTCCGCTCTGGGCCCTGCTGGCCCTCGGCTGCCTGCGGTTCGGCTCGGCTGTGAACCTGCAGCCCCAACTGGCCAGTGTGACTTTCGCCACCAACAACCCCACACTTACCACTGTGGCCTTGGAAAAGCCTCTCTGCATGTTTGACAGCAAAGAGGCCCTCACTGGCACCCACGAGGTCTACCTGTATGTCCTGGTCGACTCAGCCATTTCCAGGAATGCCTCAGTGCAAGACAGCACCAACACCCCACTGGGCTCAACGTTCCTACAAACAGAGGGTGGGAGGACAGGTCCCTACAAAGCTGTGGCCTTTGACCTGATCCCCTGCAGTGACCTGCCCAGCCTGGATGCCATTGGGGATGTGTCCAAGGCCTCACAGATCCTGAATGCCTACCTGGTCAGGGTGGGTGCCAACGGGACCTGCCTGTGGGATCCCAACTTCCAGGGCCTCTGTAACGCACCCCTGTCGGCAGCCACGGAGTACAGGTTCAAGTATGTCCTGGTCAATATGTCCACGGGCTTGGTAGAGGACCAGACCCTGTGGTCAGACCCCATCCGCACCAACCAGCTCACCCCATACTCGACGATCGACACGTGGCCAGGCCGGCGGAGCGGAGGCATGATCGTCATCACTTCCATCCTGGGCTCCCTGCCCTTCTTTCTACTTGTGGGTTTTGCTGGCGCCATTGCCCTCAGCCTCGTGGACATGGGGAGTTCTGATGGGGAAACGACTCACGACTCCCAAATCACTCAGGAGGCTGTTCCCAAGTCGCTGGGGGCCTCGGAGTCTTCCTACACGTCCGTGAACCGGGGGCCGCCACTGGACAGGGCTGAGGTGTATTCCAGCAAGCTCCAAGACTGA |
| ORF Protein Sequence | MPPLWALLALGCLRFGSAVNLQPQLASVTFATNNPTLTTVALEKPLCMFDSKEALTGTHEVYLYVLVDSAISRNASVQDSTNTPLGSTFLQTEGGRTGPYKAVAFDLIPCSDLPSLDAIGDVSKASQILNAYLVRVGANGTCLWDPNFQGLCNAPLSAATEYRFKYVLVNMSTGLVEDQTLWSDPIRTNQLTPYSTIDTWPGRRSGGMIVITSILGSLPFFLLVGFAGAIALSLVDMGSSDGETTHDSQITQEAVPKSLGASESSYTSVNRGPPLDRAEVYSSKLQD |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-MP1908-Ab | Anti-UPK3A/ UP3A/ UPIII monoclonal antibody |
| Target Antigen | GM-Tg-g-MP1908-Ag | UPK3A VLP (virus-like particle) |
| ORF Viral Vector | pGMLP004984 | Human UPK3A Lentivirus plasmid |
| ORF Viral Vector | vGMLP004984 | Human UPK3A Lentivirus particle |
Target information
| Target ID | GM-MP1908 |
| Target Name | UPK3A |
| Gene ID | 7380, 22270, 717456, 315190, 101088858, 609118, 100336102, 100052016 |
| Gene Symbol and Synonyms | 1110017C07Rik,UP3A,UPIII,UPIIIA,UPK3,UPK3A |
| Uniprot Accession | O75631 |
| Uniprot Entry Name | UPK3A_HUMAN |
| Protein Sub-location | Transmembrane Protein |
| Category | Not Available |
| Disease | Malignant neoplasm of bladder |
| Gene Ensembl | ENSG00000100373 |
| Target Classification | Not Available |
This gene encodes a member of the uroplakin family, a group of transmembrane proteins that form complexes on the apical surface of the bladder epithelium. Mutations in this gene may be associated with renal adysplasia. Alternatively spliced transcript variants have been described.[provided by RefSeq, Nov 2009]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


