Human UPK3A/UP3A/UPIII ORF/cDNA clone-Lentivirus particle (NM_006953)

Cat. No.: vGMLP004984

Pre-made Human UPK3A/UP3A/UPIII Lentiviral expression plasmid for UPK3A lentivirus packaging, UPK3A lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to UPK3A/UP3A products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP004984 Human UPK3A Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP004984
Gene Name UPK3A
Accession Number NM_006953
Gene ID 7380
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 864 bp
Gene Alias UP3A,UPIII,UPIIIA,UPK3
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCCTCCGCTCTGGGCCCTGCTGGCCCTCGGCTGCCTGCGGTTCGGCTCGGCTGTGAACCTGCAGCCCCAACTGGCCAGTGTGACTTTCGCCACCAACAACCCCACACTTACCACTGTGGCCTTGGAAAAGCCTCTCTGCATGTTTGACAGCAAAGAGGCCCTCACTGGCACCCACGAGGTCTACCTGTATGTCCTGGTCGACTCAGCCATTTCCAGGAATGCCTCAGTGCAAGACAGCACCAACACCCCACTGGGCTCAACGTTCCTACAAACAGAGGGTGGGAGGACAGGTCCCTACAAAGCTGTGGCCTTTGACCTGATCCCCTGCAGTGACCTGCCCAGCCTGGATGCCATTGGGGATGTGTCCAAGGCCTCACAGATCCTGAATGCCTACCTGGTCAGGGTGGGTGCCAACGGGACCTGCCTGTGGGATCCCAACTTCCAGGGCCTCTGTAACGCACCCCTGTCGGCAGCCACGGAGTACAGGTTCAAGTATGTCCTGGTCAATATGTCCACGGGCTTGGTAGAGGACCAGACCCTGTGGTCAGACCCCATCCGCACCAACCAGCTCACCCCATACTCGACGATCGACACGTGGCCAGGCCGGCGGAGCGGAGGCATGATCGTCATCACTTCCATCCTGGGCTCCCTGCCCTTCTTTCTACTTGTGGGTTTTGCTGGCGCCATTGCCCTCAGCCTCGTGGACATGGGGAGTTCTGATGGGGAAACGACTCACGACTCCCAAATCACTCAGGAGGCTGTTCCCAAGTCGCTGGGGGCCTCGGAGTCTTCCTACACGTCCGTGAACCGGGGGCCGCCACTGGACAGGGCTGAGGTGTATTCCAGCAAGCTCCAAGACTGA
ORF Protein Sequence MPPLWALLALGCLRFGSAVNLQPQLASVTFATNNPTLTTVALEKPLCMFDSKEALTGTHEVYLYVLVDSAISRNASVQDSTNTPLGSTFLQTEGGRTGPYKAVAFDLIPCSDLPSLDAIGDVSKASQILNAYLVRVGANGTCLWDPNFQGLCNAPLSAATEYRFKYVLVNMSTGLVEDQTLWSDPIRTNQLTPYSTIDTWPGRRSGGMIVITSILGSLPFFLLVGFAGAIALSLVDMGSSDGETTHDSQITQEAVPKSLGASESSYTSVNRGPPLDRAEVYSSKLQD

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP1908-Ab Anti-UPK3A/ UP3A/ UPIII monoclonal antibody
    Target Antigen GM-Tg-g-MP1908-Ag UPK3A VLP (virus-like particle)
    ORF Viral Vector pGMLP004984 Human UPK3A Lentivirus plasmid
    ORF Viral Vector vGMLP004984 Human UPK3A Lentivirus particle


    Target information

    Target ID GM-MP1908
    Target Name UPK3A
    Gene ID 7380, 22270, 717456, 315190, 101088858, 609118, 100336102, 100052016
    Gene Symbol and Synonyms 1110017C07Rik,UP3A,UPIII,UPIIIA,UPK3,UPK3A
    Uniprot Accession O75631
    Uniprot Entry Name UPK3A_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Malignant neoplasm of bladder
    Gene Ensembl ENSG00000100373
    Target Classification Not Available

    This gene encodes a member of the uroplakin family, a group of transmembrane proteins that form complexes on the apical surface of the bladder epithelium. Mutations in this gene may be associated with renal adysplasia. Alternatively spliced transcript variants have been described.[provided by RefSeq, Nov 2009]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.