Human BLVRA/BLVR/ BVR ORF/cDNA clone-Lentivirus particle (NM_000712)
Pre-made Human BLVRA/BLVR/ BVR Lentiviral expression plasmid for BLVRA lentivirus packaging, BLVRA lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to BLVRA/BLVR products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP005044 | Human BLVRA Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP005044 |
Gene Name | BLVRA |
Accession Number | NM_000712 |
Gene ID | 644 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 891 bp |
Gene Alias | BLVR, BVR, BVRA |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAATGCAGAGCCCGAGAGGAAGTTTGGCGTGGTGGTGGTTGGTGTTGGCCGAGCCGGCTCCGTGCGGATGAGGGACTTGCGGAATCCACACCCTTCCTCAGCGTTCCTGAACCTGATTGGCTTCGTGTCGAGAAGGGAGCTCGGGAGCATTGATGGAGTCCAGCAGATTTCTTTGGAGGATGCTCTTTCCAGCCAAGAGGTGGAGGTCGCCTATATCTGCAGTGAGAGCTCCAGCCATGAGGACTACATCAGGCAGTTCCTTAATGCTGGCAAGCACGTCCTTGTGGAATACCCCATGACACTGTCATTGGCGGCCGCTCAGGAACTGTGGGAGCTGGCTGAGCAGAAAGGAAAAGTCTTGCACGAGGAGCATGTTGAACTCTTGATGGAGGAATTCGCTTTCCTGAAAAAAGAAGTGGTGGGGAAAGACCTGCTGAAAGGGTCGCTCCTCTTCACAGCTGGCCCGTTGGAAGAAGAGCGGTTTGGCTTCCCTGCATTCAGCGGCATCTCTCGCCTGACCTGGCTGGTCTCCCTCTTTGGGGAGCTTTCTCTTGTGTCTGCCACTTTGGAAGAGCGAAAGGAAGATCAGTATATGAAAATGACAGTGTGTCTGGAGACAGAGAAGAAAAGTCCACTGTCATGGATTGAAGAAAAAGGACCTGGTCTAAAACGAAACAGATATTTAAGCTTCCATTTCAAGTCTGGGTCCTTGGAGAATGTGCCAAATGTAGGAGTGAATAAGAACATATTTCTGAAAGATCAAAATATATTTGTCCAGAAACTCTTGGGCCAGTTCTCTGAGAAGGAACTGGCTGCTGAAAAGAAACGCATCCTGCACTGCCTGGGGCTTGCAGAAGAAATCCAGAAATATTGCTGTTCAAGGAAGTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T37046-Ab | Anti-BLVRA monoclonal antibody |
Target Antigen | GM-Tg-g-T37046-Ag | BLVRA protein |
ORF Viral Vector | pGMLP005044 | Human BLVRA Lentivirus plasmid |
ORF Viral Vector | vGMLP005044 | Human BLVRA Lentivirus particle |
Target information
Target ID | GM-T37046 |
Target Name | BLVRA |
Gene ID | 644, 109778, 700980, 116599, 101088735, 475867, 504596, 100064761 |
Gene Symbol and Synonyms | 0610006A11Rik,2500001N03Rik,BLVR,BLVRA,BVR,BVRA |
Uniprot Accession | P53004 |
Uniprot Entry Name | BIEA_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Breast Cancer |
Gene Ensembl | ENSG00000106605 |
Target Classification | Not Available |
The protein encoded by this gene belongs to the biliverdin reductase family, members of which catalyze the conversion of biliverdin to bilirubin in the presence of NADPH or NADH. Mutations in this gene are associated with hyperbiliverdinemia. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2011]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.