Human RLN3/H3/ insl7 ORF/cDNA clone-Lentivirus particle (NM_080864)

Pre-made Human RLN3/H3/ insl7 Lentiviral expression plasmid for RLN3 lentivirus packaging, RLN3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to RLN3/H3 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP005057 Human RLN3 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP005057
Gene Name RLN3
Accession Number NM_080864
Gene ID 117579
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 429 bp
Gene Alias H3, insl7, RXN3, ZINS4
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCCAGGTACATGCTGCTGCTGCTCCTGGCGGTATGGGTGCTGACCGGGGAGCTGTGGCCGGGAGCTGAGGCCCGGGCAGCGCCTTACGGGGTCAGGCTTTGCGGCCGAGAATTCATCCGAGCAGTCATCTTCACCTGCGGGGGCTCCCGGTGGAGACGATCAGACATCCTGGCCCACGAGGCTATGGGAGATACCTTCCCGGATGCAGATGCTGATGAAGACAGTCTGGCAGGCGAGCTGGATGAGGCCATGGGGTCCAGCGAGTGGCTGGCCCTGACCAAGTCACCCCAGGCCTTTTACAGGGGGCGACCCAGCTGGCAAGGAACCCCTGGGGTTCTTCGGGGCAGCCGAGATGTCCTGGCTGGCCTTTCCAGCAGCTGCTGCAAGTGGGGGTGTAGCAAAAGTGAAATCAGTAGCCTTTGCTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1243-Ab Anti-REL3/ RLN3/ H3 functional antibody
    Target Antigen GM-Tg-g-SE1243-Ag RLN3 protein
    ORF Viral Vector pGMLP005057 Human RLN3 Lentivirus plasmid
    ORF Viral Vector vGMLP005057 Human RLN3 Lentivirus particle


    Target information

    Target ID GM-SE1243
    Target Name RLN3
    Gene ID 117579, 212108, 717577, 266997, 101090240, 119864730, 100300034, 100630151
    Gene Symbol and Synonyms H3,insl7,M3,RLN3,RLX3,RXN3,ZINS4
    Uniprot Accession Q8WXF3
    Uniprot Entry Name REL3_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000171136
    Target Classification Not Available

    This gene encodes a member of the relaxin family of insulin-like hormones that is expressed predominantly in the brain and plays a role in physiological processes such as stress, memory and appetite regulation. The encoded protein is a precursor that is proteolytically processed to generate a heterodimeric mature form consisting A and B chains interlinked by disulfide bonds. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2015]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.