Human ART4/ARTC4/CD297 ORF/cDNA clone-Lentivirus particle (NM_021071)

Cat. No.: vGMLP005067

Pre-made Human ART4/ARTC4/CD297 Lentiviral expression plasmid for ART4 lentivirus packaging, ART4 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to ART4/ARTC4 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP005067 Human ART4 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP005067
Gene Name ART4
Accession Number NM_021071
Gene ID 420
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 945 bp
Gene Alias ARTC4,CD297,DO,DOK1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGGTCCATTGATCAACAGATGCAAGAAGATTCTTCTCCCAACTACTGTACCTCCTGCAACGATGAGAATCTGGCTCCTTGGAGGCCTGCTGCCATTCCTGCTGCTCCTCTCTGGCCTGCAGAGACCCACAGAGGGTTCTGAGGTTGCAATTAAAATCGACTTCGACTTCGCACCAGGTTCTTTTGATGATCAGTACCAAGGCTGTAGCAAACAGGTTATGGAGAAACTAACTCAAGGGGATTATTTCACAAAAGACATAGAAGCCCAGAAGAATTATTTTAGGATGTGGCAAAAAGCCCACTTAGCCTGGCTTAACCAAGGAAAAGTTCTACCCCAGAACATGACTACCACACACGCTGTGGCTATTTTGTTTTATACATTGAACAGCAATGTTCATTCTGACTTTACTAGAGCCATGGCCTCTGTTGCCAGGACTCCACAGCAGTATGAACGTTCATTCCACTTCAAATATTTACACTACTACCTCACCTCAGCAATCCAGCTGCTGAGGAAAGACAGCATCATGGAGAATGGCACTCTGTGCTATGAGGTGCATTATAGGACGAAGGATGTCCACTTTAATGCCTACACAGGGGCCACCATTCGATTTGGCCAATTCCTCTCCACATCCCTCCTGAAAGAAGAGGCACAGGAGTTTGGGAACCAGACACTATTTACCATATTCACCTGCCTGGGTGCACCTGTACAGTACTTCTCCCTCAAGAAGGAAGTCTTGATCCCTCCCTATGAGCTGTTTAAAGTTATAAATATGAGCTACCACCCAAGAGGAGACTGGTTGCAGTTGAGGTCAACTGGGAACCTGAGCACATATAACTGTCAGCTGCTAAAAGCTTCCAGCAAGAAATGCATCCCTGATCCTATAGCTATTGCATCTCTCTCCTTTTTGACCAGTGTCATCATCTTTTCCAAAAGCAGAGTATAA
ORF Protein Sequence MGPLINRCKKILLPTTVPPATMRIWLLGGLLPFLLLLSGLQRPTEGSEVAIKIDFDFAPGSFDDQYQGCSKQVMEKLTQGDYFTKDIEAQKNYFRMWQKAHLAWLNQGKVLPQNMTTTHAVAILFYTLNSNVHSDFTRAMASVARTPQQYERSFHFKYLHYYLTSAIQLLRKDSIMENGTLCYEVHYRTKDVHFNAYTGATIRFGQFLSTSLLKEEAQEFGNQTLFTIFTCLGAPVQYFSLKKEVLIPPYELFKVINMSYHPRGDWLQLRSTGNLSTYNCQLLKASSKKCIPDPIAIASLSFLTSVIIFSKSRV

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP0088-Ab Anti-NAR4/ ART4/ ARTC4 monoclonal antibody
    Target Antigen GM-Tg-g-MP0088-Ag ART4 VLP (virus-like particle)
    ORF Viral Vector pGMLP005067 Human ART4 Lentivirus plasmid
    ORF Viral Vector vGMLP005067 Human ART4 Lentivirus particle


    Target information

    Target ID GM-MP0088
    Target Name ART4
    Gene ID 420, 109978, 699934, 312806, 101096491, 486668, 407146, 100067242
    Gene Symbol and Synonyms 4432404K01Rik,ART4,ARTC4,ATR4,CD297,DO,DO/ART4,DOK1,Dombrock
    Uniprot Accession Q93070
    Uniprot Entry Name NAR4_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000111339
    Target Classification Not Available

    This gene encodes a protein that contains a mono-ADP-ribosylation (ART) motif. It is a member of the ADP-ribosyltransferase gene family but enzymatic activity has not been demonstrated experimentally. Antigens of the Dombrock blood group system are located on the gene product, which is glycosylphosphatidylinosotol-anchored to the erythrocyte membrane. Allelic variants, some of which lead to adverse transfusion reactions, are known. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.