Human SLC30A8/ZnT-8/ZNT8 ORF/cDNA clone-Lentivirus particle (NM_173851)

Cat. No.: vGMLP005116

Pre-made Human SLC30A8/ZnT-8/ZNT8 Lentiviral expression plasmid for SLC30A8 lentivirus packaging, SLC30A8 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to SLC30A8/ZnT-8 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP005116 Human SLC30A8 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP005116
Gene Name SLC30A8
Accession Number NM_173851
Gene ID 169026
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1110 bp
Gene Alias ZnT-8,ZNT8
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGAGTTTCTTGAAAGAACGTATCTTGTGAATGATAAAGCTGCCAAGATGTATGCTTTCACACTAGAAAGTGTGGAACTCCAACAGAAACCGGTGAATAAAGATCAGTGTCCCAGAGAGAGACCAGAGGAGCTGGAGTCAGGAGGCATGTACCACTGCCACAGTGGCTCCAAGCCCACAGAAAAGGGGGCGAATGAGTACGCCTATGCCAAGTGGAAACTCTGTTCTGCTTCAGCAATATGCTTCATTTTCATGATTGCAGAGGTCGTGGGTGGGCACATTGCTGGGAGTCTTGCTGTTGTCACAGATGCTGCCCACCTCTTAATTGACCTGACCAGTTTCCTGCTCAGTCTCTTCTCCCTGTGGTTGTCATCGAAGCCTCCCTCTAAGCGGCTGACATTTGGATGGCACCGAGCAGAGATCCTTGGTGCCCTGCTCTCCATCCTGTGCATCTGGGTGGTGACTGGCGTGCTAGTGTACCTGGCATGTGAGCGCCTGCTGTATCCTGATTACCAGATCCAGGCGACTGTGATGATCATCGTTTCCAGCTGCGCAGTGGCGGCCAACATTGTACTAACTGTGGTTTTGCACCAGAGATGCCTTGGCCACAATCACAAGGAAGTACAAGCCAATGCCAGCGTCAGAGCTGCTTTTGTGCATGCCCTTGGAGATCTATTTCAGAGTATCAGTGTGCTAATTAGTGCACTTATTATCTACTTTAAGCCAGAGTATAAAATAGCCGACCCAATCTGCACATTCATCTTTTCCATCCTGGTCTTGGCCAGCACCATCACTATCTTAAAGGACTTCTCCATCTTACTCATGGAAGGTGTGCCAAAGAGCCTGAATTACAGTGGTGTGAAAGAGCTTATTTTAGCAGTCGACGGGGTGCTGTCTGTGCACAGCCTGCACATCTGGTCTCTAACAATGAATCAAGTAATTCTCTCAGCTCATGTTGCTACAGCAGCCAGCCGGGACAGCCAAGTGGTTCGGAGAGAAATTGCTAAAGCCCTTAGCAAAAGCTTTACGATGCACTCACTCACCATTCAGATGGAATCTCCAGTTGACCAGGACCCCGACTGCCTTTTCTGTGAAGACCCCTGTGACTAG
ORF Protein Sequence MEFLERTYLVNDKAAKMYAFTLESVELQQKPVNKDQCPRERPEELESGGMYHCHSGSKPTEKGANEYAYAKWKLCSASAICFIFMIAEVVGGHIAGSLAVVTDAAHLLIDLTSFLLSLFSLWLSSKPPSKRLTFGWHRAEILGALLSILCIWVVTGVLVYLACERLLYPDYQIQATVMIIVSSCAVAANIVLTVVLHQRCLGHNHKEVQANASVRAAFVHALGDLFQSISVLISALIIYFKPEYKIADPICTFIFSILVLASTITILKDFSILLMEGVPKSLNYSGVKELILAVDGVLSVHSLHIWSLTMNQVILSAHVATAASRDSQVVRREIAKALSKSFTMHSLTIQMESPVDQDPDCLFCEDPCD

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T12714-Ab Anti-ZNT8/ SLC30A8/ ZnT-8 monoclonal antibody
    Target Antigen GM-Tg-g-T12714-Ag SLC30A8 VLP (virus-like particle)
    ORF Viral Vector pGMLP005116 Human SLC30A8 Lentivirus plasmid
    ORF Viral Vector vGMLP005116 Human SLC30A8 Lentivirus particle


    Target information

    Target ID GM-T12714
    Target Name SLC30A8
    Gene ID 169026, 239436, 701127, 299903, 101096203, 482022, 100336719, 100056898
    Gene Symbol and Synonyms C820002P14Rik,SLC30A8,ZnT-8,ZNT8
    Uniprot Accession Q8IWU4
    Uniprot Entry Name ZNT8_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000164756
    Target Classification Not Available

    The protein encoded by this gene is a zinc efflux transporter involved in the accumulation of zinc in intracellular vesicles. This gene is expressed at a high level only in the pancreas, particularly in islets of Langerhans. The encoded protein colocalizes with insulin in the secretory pathway granules of the insulin-secreting INS-1 cells. Allelic variants of this gene exist that confer susceptibility to diabetes mellitus, noninsulin-dependent (NIDDM). Several transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2010]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.