Human POMK/MDDGA12/MDDGC12 ORF/cDNA clone-Lentivirus particle (NM_001277971.1)
Cat. No.: vGMLP005196
Pre-made Human POMK/MDDGA12/MDDGC12 Lentiviral expression plasmid for POMK lentivirus packaging, POMK lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
POMK/MDDGA12 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP005196 | Human POMK Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP005196 |
Gene Name | POMK |
Accession Number | NM_001277971.1 |
Gene ID | 84197 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 1053 bp |
Gene Alias | MDDGA12,MDDGC12,SGK196 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGGAAAAGCAGCCCCAGAACAGCAGGAGAGGCCTCGCCCCCCGAGAGGTGCCGCCAGCTGTTGGGCTGCTGCTGATCATGGCCCTGATGAATACTCTGCTCTACCTCTGCCTCGACCACTTCTTCATCGCTCCTCGACAATCCACTGTGGACCCCACACACTGTCCCTATGGTCACTTCAGGATAGGACAGATGAAAAACTGCTCACCTTGGCTGTCCTGCGAGGAGCTGAGAACAGAAGTGAGACAGCTGAAGCGTGTTGGGGAAGGAGCTGTAAAGAGAGTCTTTCTGTCTGAGTGGAAGGAGCACAAAGTTGCACTCTCACAGCTCACCAGCCTGGAGATGAAAGATGATTTCCTCCATGGACTGCAGATGCTGAAATCTCTCCAAGGCACACATGTTGTCACGCTGCTTGGCTATTGTGAGGATGACAACACTATGCTTACTGAATATCACCCTCTAGGTTCCTTGAGTAACCTGGAAGAAACACTAAACCTTTCAAAGTACCAAAATGTGAACACGTGGCAGCACAGGCTGGAGCTGGCCATGGACTATGTCAGCATCATTAATTACCTGCACCACAGCCCTGTGGGCACACGGGTCATGTGCGACTCCAACGACCTGCCGAAGACACTGTCCCAGTATCTGCTAACAAGCAACTTCAGCATTTTGGCAAATGACTTGGACGCCTTACCCCTGGTGAACCACAGCTCCGGGATGCTGGTGAAGTGCGGCCACAGGGAGCTGCATGGGGATTTCGTGGCTCCAGAGCAACTGTGGCCCTATGGAGAGGACGTGCCTTTCCACGATGATCTCATGCCCTCATATGATGAGAAGATTGACATTTGGAAGATCCCAGACATCTCCAGTTTCCTTCTGGGGCACATTGAAGGGAGTGATATGGTCCGATTCCATTTGTTTGATATTCACAAAGCATGCAAGAGCCAGACTCCCTCAGAAAGACCCACTGCCCAGGACGTTCTGGAGACCTACCAGAAGGTCTTGGATACACTTAGAGATGCCATGATGTCTCAGGCAAGAGAGATGCTGTGA |
ORF Protein Sequence | MEKQPQNSRRGLAPREVPPAVGLLLIMALMNTLLYLCLDHFFIAPRQSTVDPTHCPYGHFRIGQMKNCSPWLSCEELRTEVRQLKRVGEGAVKRVFLSEWKEHKVALSQLTSLEMKDDFLHGLQMLKSLQGTHVVTLLGYCEDDNTMLTEYHPLGSLSNLEETLNLSKYQNVNTWQHRLELAMDYVSIINYLHHSPVGTRVMCDSNDLPKTLSQYLLTSNFSILANDLDALPLVNHSSGMLVKCGHRELHGDFVAPEQLWPYGEDVPFHDDLMPSYDEKIDIWKIPDISSFLLGHIEGSDMVRFHLFDIHKACKSQTPSERPTAQDVLETYQKVLDTLRDAMMSQAREML |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-IP1428-Ab | Anti-POMK monoclonal antibody |
Target Antigen | GM-Tg-g-IP1428-Ag | POMK protein |
ORF Viral Vector | pGMLP005196 | Human POMK Lentivirus plasmid |
ORF Viral Vector | vGMLP005196 | Human POMK Lentivirus particle |
Target information
Target ID | GM-IP1428 |
Target Name | POMK |
Gene ID | 84197, 74653, 706318, 306549, 102902090, 482834, 514490, 100053457 |
Gene Symbol and Synonyms | 4930444A02Rik,MDDGA12,MDDGC12,POMK,RGD1310810,SGK196 |
Uniprot Accession | Q9H5K3 |
Uniprot Entry Name | SG196_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000185900 |
Target Classification | Kinase |
This gene encodes a protein that may be involved in the presentation of the laminin-binding O-linked carbohydrate chain of alpha-dystroglycan (a-DG), which forms transmembrane linkages between the extracellular matrix and the exoskeleton. Some pathogens use this O-linked carbohydrate unit for host entry. Loss of function compound heterozygous mutations in this gene were found in a human patient affected by the Walker-Warburg syndrome (WWS) phenotype. Mice lacking this gene contain misplaced neurons (heterotopia) in some regions of the brain, possibly from defects in neuronal migration. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2013]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.