Human TK1/TK2 ORF/cDNA clone-Lentivirus particle (NM_003258.4)

Cat. No.: vGMLP005411

Pre-made Human TK1/TK2 Lentiviral expression plasmid for TK1 lentivirus packaging, TK1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to TK1/TK2 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP005411 Human TK1 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP005411
Gene Name TK1
Accession Number NM_003258.4
Gene ID 7083
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 705 bp
Gene Alias TK2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAGCTGCATTAACCTGCCCACTGTGCTGCCTGGCTCCCCCAGCAAGACCCGGGGGCAGATCCAGGTGATTCTCGGGCCGATGTTCTCAGGAAAAAGCACAGAGTTGATGAGACGCGTCCGTCGCTTCCAGATTGCTCAGTACAAGTGCCTGGTGATCAAGTATGCCAAAGACACTCGCTACAGCAGCAGCTTCTGCACACATGACCGGAACACCATGGAGGCACTGCCCGCCTGCCTGCTCCGAGACGTGGCCCAGGAGGCCCTGGGCGTGGCTGTCATAGGCATCGACGAGGGGCAGTTTTTCCCTGACATCGTGGAGTTCTGCGAGGCCATGGCCAACGCCGGGAAGACCGTAATTGTGGCTGCACTGGATGGGACCTTCCAGAGGAAGCCATTTGGGGCCATCCTGAACCTGGTGCCGCTGGCCGAGAGCGTGGTGAAGCTGACGGCGGTGTGCATGGAGTGCTTCCGGGAAGCCGCCTATACCAAGAGGCTCGGCACAGAGAAGGAGGTCGAGGTGATTGGGGGAGCAGACAAGTACCACTCCGTGTGTCGGCTCTGCTACTTCAAGAAGGCCTCAGGCCAGCCTGCCGGGCCGGACAACAAAGAGAACTGCCCAGTGCCAGGAAAGCCAGGGGAAGCCGTGGCTGCCAGGAAGCTCTTTGCCCCACAGCAGATTCTGCAATGCAGCCCTGCCAACTGA
ORF Protein Sequence MSCINLPTVLPGSPSKTRGQIQVILGPMFSGKSTELMRRVRRFQIAQYKCLVIKYAKDTRYSSSFCTHDRNTMEALPACLLRDVAQEALGVAVIGIDEGQFFPDIVEFCEAMANAGKTVIVAALDGTFQRKPFGAILNLVPLAESVVKLTAVCMECFREAAYTKRLGTEKEVEVIGGADKYHSVCRLCYFKKASGQPAGPDNKENCPVPGKPGEAVAARKLFAPQQILQCSPAN

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T30081-Ab Anti-TK1 monoclonal antibody
    Target Antigen GM-Tg-g-T30081-Ag TK1 protein
    ORF Viral Vector pGMLP005411 Human TK1 Lentivirus plasmid
    ORF Viral Vector vGMLP005411 Human TK1 Lentivirus particle


    Target information

    Target ID GM-T30081
    Target Name TK1
    Gene ID 7083, 21877, 709403, 24834, 101101270, 100855947, 504652, 100057908
    Gene Symbol and Synonyms D530002A18Rik,Tk,Tk-1,TK1,Tk1a,Tk1b,TK2
    Uniprot Accession P04183
    Uniprot Entry Name KITH_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target, Diagnostics Biomarker, Immuno-oncology Target
    Disease Not Available
    Gene Ensembl ENSG00000167900
    Target Classification Checkpoint-Immuno Oncology

    The protein encoded by this gene is a cytosolic enzyme that catalyzes the addition of a gamma-phosphate group to thymidine. This creates dTMP and is the first step in the biosynthesis of dTTP, which is one component required for DNA replication. The encoded protein, whose levels fluctuate depending on the cell cycle stage, can act as a low activity dimer or a high activity tetramer. High levels of this protein have been used as a biomarker for diagnosing and categorizing many types of cancers. [provided by RefSeq, Oct 2016]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.