Human WNT9A/WNT14 ORF/cDNA clone-Lentivirus particle (NM_003395.2)
Cat. No.: vGMLP005579
Pre-made Human WNT9A/WNT14 Lentiviral expression plasmid for WNT9A lentivirus packaging, WNT9A lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
WNT9A/WNT14 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP005579 | Human WNT9A Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP005579 |
Gene Name | WNT9A |
Accession Number | NM_003395.2 |
Gene ID | 7483 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 1098 bp |
Gene Alias | WNT14 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGCTGGATGGGTCCCCGCTGGCGCGCTGGCTGGCCGCGGCCTTCGGGCTGACGCTGCTGCTCGCCGCGCTGCGCCCTTCGGCCGCCTACTTCGGGCTGACGGGCAGCGAGCCCCTGACCATCCTCCCGCTGACCCTGGAGCCAGAGGCGGCTGCCCAGGCGCACTACAAGGCCTGCGACCGGCTGAAGCTGGAGCGGAAGCAGCGGCGCATGTGCCGCCGGGACCCGGGCGTGGCAGAGACGCTGGTGGAGGCCGTGAGCATGAGTGCGCTCGAGTGCCAGTTCCAGTTCCGCTTTGAGCGCTGGAACTGCACGCTGGAGGGCCGCTACCGGGCCAGCCTGCTCAAGCGAGGCTTCAAGGAGACTGCCTTCCTCTATGCCATCTCCTCGGCTGGCCTGACGCACGCACTGGCCAAGGCGTGCAGCGCGGGCCGCATGGAGCGCTGTACCTGCGATGAGGCACCCGACCTGGAGAACCGTGAGGCCTGGCAGTGGGGGGGCTGCGGAGACAACCTTAAGTACAGCAGCAAGTTCGTCAAGGAATTCCTGGGCAGACGGTCAAGCAAGGATCTGCGAGCCCGTGTGGACTTCCACAACAACCTCGTGGGTGTGAAGGTGATCAAGGCTGGGGTGGAGACCACCTGCAAGTGCCACGGCGTGTCAGGCTCATGCACGGTGCGGACCTGCTGGCGGCAGTTGGCGCCTTTCCATGAGGTGGGCAAGCATCTGAAGCACAAGTATGAGACGGCACTCAAGGTGGGCAGCACCACCAATGAAGCTGCCGGCGAGGCAGGTGCCATCTCCCCACCACGGGGCCGTGCCTCGGGGGCAGGTGGCAGCGACCCGCTGCCCCGCACTCCAGAGCTGGTGCACCTGGATGACTCGCCTAGCTTCTGCCTGGCTGGCCGCTTCTCCCCGGGCACCGCTGGCCGTAGGTGCCACCGTGAGAAGAACTGCGAGAGCATCTGCTGTGGCCGCGGCCATAACACACAGAGCCGGGTGGTGACAAGGCCCTGCCAGTGCCAGGTGCGTTGGTGCTGCTATGTGGAGTGCAGGCAGTGCACGCAGCGTGAGGAGGTCTACACCTGCAAGGGCTGA |
ORF Protein Sequence | MLDGSPLARWLAAAFGLTLLLAALRPSAAYFGLTGSEPLTILPLTLEPEAAAQAHYKACDRLKLERKQRRMCRRDPGVAETLVEAVSMSALECQFQFRFERWNCTLEGRYRASLLKRGFKETAFLYAISSAGLTHALAKACSAGRMERCTCDEAPDLENREAWQWGGCGDNLKYSSKFVKEFLGRRSSKDLRARVDFHNNLVGVKVIKAGVETTCKCHGVSGSCTVRTCWRQLAPFHEVGKHLKHKYETALKVGSTTNEAAGEAGAISPPRGRASGAGGSDPLPRTPELVHLDDSPSFCLAGRFSPGTAGRRCHREKNCESICCGRGHNTQSRVVTRPCQCQVRWCCYVECRQCTQREEVYTCKG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE0559-Ab | Anti-WNT9A/ WNT14 functional antibody |
Target Antigen | GM-Tg-g-SE0559-Ag | WNT9A protein |
Cytokine | cks-Tg-g-GM-SE0559 | wingless-type MMTV integration site family, member 9A (WNT9A) protein & antibody |
ORF Viral Vector | pGMLP005579 | Human WNT9A Lentivirus plasmid |
ORF Viral Vector | pGMAD001279 | Human WNT9A Adenovirus plasmid |
ORF Viral Vector | pGMPC001795 | Human WNT9A Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | vGMLP005579 | Human WNT9A Lentivirus particle |
ORF Viral Vector | vGMAD001279 | Human WNT9A Adenovirus particle |
Target information
Target ID | GM-SE0559 |
Target Name | WNT9A |
Gene ID | 7483, 216795, 696326, 287357, 111560436, 482209, 511308, 100061110 |
Gene Symbol and Synonyms | wnt-14,WNT14,WNT9A |
Uniprot Accession | O14904 |
Uniprot Entry Name | WNT9A_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Cytokine Target |
Disease | Not Available |
Gene Ensembl | ENSG00000143816 |
Target Classification | Not Available |
The WNT gene family consists of structurally related genes that encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It is expressed in gastric cancer cell lines. The protein encoded by this gene shows 75% amino acid identity to chicken Wnt14, which has been shown to play a central role in initiating synovial joint formation in the chick limb. This gene is clustered with another family member, WNT3A, in the chromosome 1q42 region. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.