Human WNT9A/WNT14 ORF/cDNA clone-Lentivirus particle (NM_003395.2)

Cat. No.: vGMLP005579

Pre-made Human WNT9A/WNT14 Lentiviral expression plasmid for WNT9A lentivirus packaging, WNT9A lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to WNT9A/WNT14 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP005579 Human WNT9A Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP005579
Gene Name WNT9A
Accession Number NM_003395.2
Gene ID 7483
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1098 bp
Gene Alias WNT14
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCTGGATGGGTCCCCGCTGGCGCGCTGGCTGGCCGCGGCCTTCGGGCTGACGCTGCTGCTCGCCGCGCTGCGCCCTTCGGCCGCCTACTTCGGGCTGACGGGCAGCGAGCCCCTGACCATCCTCCCGCTGACCCTGGAGCCAGAGGCGGCTGCCCAGGCGCACTACAAGGCCTGCGACCGGCTGAAGCTGGAGCGGAAGCAGCGGCGCATGTGCCGCCGGGACCCGGGCGTGGCAGAGACGCTGGTGGAGGCCGTGAGCATGAGTGCGCTCGAGTGCCAGTTCCAGTTCCGCTTTGAGCGCTGGAACTGCACGCTGGAGGGCCGCTACCGGGCCAGCCTGCTCAAGCGAGGCTTCAAGGAGACTGCCTTCCTCTATGCCATCTCCTCGGCTGGCCTGACGCACGCACTGGCCAAGGCGTGCAGCGCGGGCCGCATGGAGCGCTGTACCTGCGATGAGGCACCCGACCTGGAGAACCGTGAGGCCTGGCAGTGGGGGGGCTGCGGAGACAACCTTAAGTACAGCAGCAAGTTCGTCAAGGAATTCCTGGGCAGACGGTCAAGCAAGGATCTGCGAGCCCGTGTGGACTTCCACAACAACCTCGTGGGTGTGAAGGTGATCAAGGCTGGGGTGGAGACCACCTGCAAGTGCCACGGCGTGTCAGGCTCATGCACGGTGCGGACCTGCTGGCGGCAGTTGGCGCCTTTCCATGAGGTGGGCAAGCATCTGAAGCACAAGTATGAGACGGCACTCAAGGTGGGCAGCACCACCAATGAAGCTGCCGGCGAGGCAGGTGCCATCTCCCCACCACGGGGCCGTGCCTCGGGGGCAGGTGGCAGCGACCCGCTGCCCCGCACTCCAGAGCTGGTGCACCTGGATGACTCGCCTAGCTTCTGCCTGGCTGGCCGCTTCTCCCCGGGCACCGCTGGCCGTAGGTGCCACCGTGAGAAGAACTGCGAGAGCATCTGCTGTGGCCGCGGCCATAACACACAGAGCCGGGTGGTGACAAGGCCCTGCCAGTGCCAGGTGCGTTGGTGCTGCTATGTGGAGTGCAGGCAGTGCACGCAGCGTGAGGAGGTCTACACCTGCAAGGGCTGA
ORF Protein Sequence MLDGSPLARWLAAAFGLTLLLAALRPSAAYFGLTGSEPLTILPLTLEPEAAAQAHYKACDRLKLERKQRRMCRRDPGVAETLVEAVSMSALECQFQFRFERWNCTLEGRYRASLLKRGFKETAFLYAISSAGLTHALAKACSAGRMERCTCDEAPDLENREAWQWGGCGDNLKYSSKFVKEFLGRRSSKDLRARVDFHNNLVGVKVIKAGVETTCKCHGVSGSCTVRTCWRQLAPFHEVGKHLKHKYETALKVGSTTNEAAGEAGAISPPRGRASGAGGSDPLPRTPELVHLDDSPSFCLAGRFSPGTAGRRCHREKNCESICCGRGHNTQSRVVTRPCQCQVRWCCYVECRQCTQREEVYTCKG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0559-Ab Anti-WNT9A/ WNT14 functional antibody
    Target Antigen GM-Tg-g-SE0559-Ag WNT9A protein
    Cytokine cks-Tg-g-GM-SE0559 wingless-type MMTV integration site family, member 9A (WNT9A) protein & antibody
    ORF Viral Vector pGMLP005579 Human WNT9A Lentivirus plasmid
    ORF Viral Vector pGMAD001279 Human WNT9A Adenovirus plasmid
    ORF Viral Vector pGMPC001795 Human WNT9A Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLP005579 Human WNT9A Lentivirus particle
    ORF Viral Vector vGMAD001279 Human WNT9A Adenovirus particle


    Target information

    Target ID GM-SE0559
    Target Name WNT9A
    Gene ID 7483, 216795, 696326, 287357, 111560436, 482209, 511308, 100061110
    Gene Symbol and Synonyms wnt-14,WNT14,WNT9A
    Uniprot Accession O14904
    Uniprot Entry Name WNT9A_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Cytokine Target
    Disease Not Available
    Gene Ensembl ENSG00000143816
    Target Classification Not Available

    The WNT gene family consists of structurally related genes that encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It is expressed in gastric cancer cell lines. The protein encoded by this gene shows 75% amino acid identity to chicken Wnt14, which has been shown to play a central role in initiating synovial joint formation in the chick limb. This gene is clustered with another family member, WNT3A, in the chromosome 1q42 region. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.