Human RAB25/CATX-8/RAB11C ORF/cDNA clone-Lentivirus particle (NM_020387.3)

Cat. No.: vGMLV000081

Pre-made Human RAB25/CATX-8/RAB11C Lentiviral expression plasmid for RAB25 lentivirus packaging, RAB25 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to RAB25/CATX-8 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLV000081 Human RAB25 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLV000081
Gene Name RAB25
Accession Number NM_020387.3
Gene ID 57111
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 642 bp
Gene Alias CATX-8,RAB11C
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGGGAATGGAACTGAGGAAGATTATAACTTTGTCTTCAAGGTGGTGCTGATCGGCGAATCAGGTGTGGGGAAGACCAATCTACTCTCCCGATTCACGCGCAATGAGTTCAGCCACGACAGCCGCACCACCATCGGGGTTGAGTTCTCCACCCGCACTGTGATGTTGGGCACCGCTGCTGTCAAGGCTCAGATCTGGGACACAGCTGGCCTGGAGCGGTACCGAGCCATCACCTCGGCGTACTATCGTGGTGCAGTGGGGGCCCTCCTGGTGTTTGACCTAACCAAGCACCAGACCTATGCTGTGGTGGAGCGATGGCTGAAGGAGCTCTATGACCATGCTGAAGCCACGATCGTCGTCATGCTCGTGGGTAACAAAAGTGACCTCAGCCAGGCCCGGGAAGTGCCCACTGAGGAGGCCCGAATGTTCGCTGAAAACAATGGACTGCTCTTCCTGGAGACCTCAGCCCTGGACTCTACCAATGTTGAGCTAGCCTTTGAGACTGTCCTGAAAGAAATCTTTGCGAAGGTGTCCAAGCAGAGACAGAACAGCATCCGGACCAATGCCATCACTCTGGGCAGTGCCCAGGCTGGACAGGAGCCTGGCCCTGGGGAGAAGAGGGCCTGTTGCATCAGCCTCTGA
ORF Protein Sequence MGNGTEEDYNFVFKVVLIGESGVGKTNLLSRFTRNEFSHDSRTTIGVEFSTRTVMLGTAAVKAQIWDTAGLERYRAITSAYYRGAVGALLVFDLTKHQTYAVVERWLKELYDHAEATIVVMLVGNKSDLSQAREVPTEEARMFAENNGLLFLETSALDSTNVELAFETVLKEIFAKVSKQRQNSIRTNAITLGSAQAGQEPGPGEKRACCISL

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP2686-Ab Anti-RAB25 monoclonal antibody
    Target Antigen GM-Tg-g-IP2686-Ag RAB25 protein
    ORF Viral Vector pGMLP003138 Human RAB25 Lentivirus plasmid
    ORF Viral Vector pGMLV000081 Human RAB25 Lentivirus plasmid
    ORF Viral Vector vGMLP003138 Human RAB25 Lentivirus particle
    ORF Viral Vector vGMLV000081 Human RAB25 Lentivirus particle


    Target information

    Target ID GM-IP2686
    Target Name RAB25
    Gene ID 57111, 53868, 718131, 310632, 101084416, 490418, 506482, 100057624
    Gene Symbol and Synonyms CATX-8,RAB11C,RAB25
    Uniprot Accession P57735
    Uniprot Entry Name RAB25_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000132698
    Target Classification Not Available

    The protein encoded by this gene is a member of the RAS superfamily of small GTPases. The encoded protein is involved in membrane trafficking and cell survival. This gene has been found to be a tumor suppressor and an oncogene, depending on the context. Two variants, one protein-coding and the other not, have been found for this gene. [provided by RefSeq, Nov 2015]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.