Human ANXA2/ANX2/ANX2L4 ORF/cDNA clone-Lentivirus particle (NM_001002858.2)
Cat. No.: vGMLV000652
Pre-made Human ANXA2/ANX2/ANX2L4 Lentiviral expression plasmid for ANXA2 lentivirus packaging, ANXA2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
ANXA2/ANX2 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
| Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
|---|---|---|---|
| vGMLV000652 | Human ANXA2 Lentivirus particle | Pilot Grade | 1.0E+8TU |
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| Research Grade | 1.0E+8TU | ||
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMLV000652 |
| Gene Name | ANXA2 |
| Accession Number | NM_001002858.2 |
| Gene ID | 302 |
| Species | Human |
| Product Type | Lentivirus particle (overexpression) |
| Insert Length | 1074 bp |
| Gene Alias | ANX2,ANX2L4,CAL1H,HEL-S-270,LIP2,LPC2,LPC2D,P36,PAP-IV |
| Fluorescent Reporter | Null |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGGGCCGCCAGCTAGCGGGGTGTGGAGACGCTGGGAAGAAGGCTTCCTTCAAAATGTCTACTGTTCACGAAATCCTGTGCAAGCTCAGCTTGGAGGGTGATCACTCTACACCCCCAAGTGCATATGGGTCTGTCAAAGCCTATACTAACTTTGATGCTGAGCGGGATGCTTTGAACATTGAAACAGCCATCAAGACCAAAGGTGTGGATGAGGTCACCATTGTCAACATTTTGACCAACCGCAGCAATGCACAGAGACAGGATATTGCCTTCGCCTACCAGAGAAGGACCAAAAAGGAACTTGCATCAGCACTGAAGTCAGCCTTATCTGGCCACCTGGAGACGGTGATTTTGGGCCTATTGAAGACACCTGCTCAGTATGACGCTTCTGAGCTAAAAGCTTCCATGAAGGGGCTGGGAACCGACGAGGACTCTCTCATTGAGATCATCTGCTCCAGAACCAACCAGGAGCTGCAGGAAATTAACAGAGTCTACAAGGAAATGTACAAGACTGATCTGGAGAAGGACATTATTTCGGACACATCTGGTGACTTCCGCAAGCTGATGGTTGCCCTGGCAAAGGGTAGAAGAGCAGAGGATGGCTCTGTCATTGATTATGAACTGATTGACCAAGATGCTCGGGATCTCTATGACGCTGGAGTGAAGAGGAAAGGAACTGATGTTCCCAAGTGGATCAGCATCATGACCGAGCGGAGCGTGCCCCACCTCCAGAAAGTATTTGATAGGTACAAGAGTTACAGCCCTTATGACATGTTGGAAAGCATCAGGAAAGAGGTTAAAGGAGACCTGGAAAATGCTTTCCTGAACCTGGTTCAGTGCATTCAGAACAAGCCCCTGTATTTTGCTGATCGGCTGTATGACTCCATGAAGGGCAAGGGGACGCGAGATAAGGTCCTGATCAGAATCATGGTCTCCCGCAGTGAAGTGGACATGTTGAAAATTAGGTCTGAATTCAAGAGAAAGTACGGCAAGTCCCTGTACTATTATATCCAGCAAGACACTAAGGGCGACTACCAGAAAGCGCTGCTGTACCTGTGTGGTGGAGATGACTGA |
| ORF Protein Sequence | MGRQLAGCGDAGKKASFKMSTVHEILCKLSLEGDHSTPPSAYGSVKAYTNFDAERDALNIETAIKTKGVDEVTIVNILTNRSNAQRQDIAFAYQRRTKKELASALKSALSGHLETVILGLLKTPAQYDASELKASMKGLGTDEDSLIEIICSRTNQELQEINRVYKEMYKTDLEKDIISDTSGDFRKLMVALAKGRRAEDGSVIDYELIDQDARDLYDAGVKRKGTDVPKWISIMTERSVPHLQKVFDRYKSYSPYDMLESIRKEVKGDLENAFLNLVQCIQNKPLYFADRLYDSMKGKGTRDKVLIRIMVSRSEVDMLKIRSEFKRKYGKSLYYYIQQDTKGDYQKALLYLCGGDD |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-T04386-Ab | Anti-ANXA2/ ANX2/ ANX2L4 monoclonal antibody |
| Target Antigen | GM-Tg-g-T04386-Ag | ANXA2 VLP (virus-like particle) |
| ORF Viral Vector | pGMLP004063 | Human ANXA2 Lentivirus plasmid |
| ORF Viral Vector | pGMLP004100 | Human ANXA2 Lentivirus plasmid |
| ORF Viral Vector | pGMLV000652 | Human ANXA2 Lentivirus plasmid |
| ORF Viral Vector | pGMAP000385 | Human ANXA2 Adenovirus plasmid |
| ORF Viral Vector | pGMPC000610 | Human ANXA2 Mammalian (Non-Viral Vector) plasmid |
| ORF Viral Vector | vGMLP004063 | Human ANXA2 Lentivirus particle |
| ORF Viral Vector | vGMLP004100 | Human ANXA2 Lentivirus particle |
| ORF Viral Vector | vGMLV000652 | Human ANXA2 Lentivirus particle |
| ORF Viral Vector | vGMAP000385 | Human ANXA2 Adenovirus particle |
Target information
| Target ID | GM-T04386 |
| Target Name | ANXA2 |
| Gene ID | 302, 12306, 706240, 56611, 101093022, 403435, 282689, 100054320 |
| Gene Symbol and Synonyms | Annexin-2,ANX2,ANX2L4,ANXA2,CAL1H,HEL-S-270,LIP2,LPC2,LPC2D,P36,PAP-IV |
| Uniprot Accession | P07355 |
| Uniprot Entry Name | ANXA2_HUMAN |
| Protein Sub-location | Transmembrane Protein |
| Category | Therapeutics Target |
| Disease | Ovary Cancer |
| Gene Ensembl | ENSG00000182718 |
| Target Classification | Not Available |
This gene encodes a member of the annexin family. Members of this calcium-dependent phospholipid-binding protein family play a role in the regulation of cellular growth and in signal transduction pathways. This protein functions as an autocrine factor which heightens osteoclast formation and bone resorption. This gene has three pseudogenes located on chromosomes 4, 9 and 10, respectively. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. Annexin A2 expression has been found to correlate with resistance to treatment against various cancer forms. [provided by RefSeq, Dec 2019]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


