Human NR4A2/HZF-3/ NOT ORF/cDNA clone-Lentivirus particle (NM_006186.4)

Pre-made Human NR4A2/HZF-3/ NOT Lentiviral expression plasmid for NR4A2 lentivirus packaging, NR4A2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to NR4A2/HZF-3 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLV000901 Human NR4A2 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLV000901
Gene Name NR4A2
Accession Number NM_006186.4
Gene ID 4929
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1797 bp
Gene Alias HZF-3, NOT, NURR1, RNR1, TINUR
Fluorescent Reporter Luciferase
Mammalian Cell Selection Puromyocinmyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCCTTGTGTTCAGGCGCAGTATGGGTCCTCGCCTCAAGGAGCCAGCCCCGCTTCTCAGAGCTACAGTTACCACTCTTCGGGAGAATACAGCTCCGATTTCTTAACTCCAGAGTTTGTCAAGTTTAGCATGGACCTCACCAACACTGAAATCACTGCCACCACTTCTCTCCCCAGCTTCAGTACCTTTATGGACAACTACAGCACAGGCTACGACGTCAAGCCACCTTGCTTGTACCAAATGCCCCTGTCCGGACAGCAGTCCTCCATTAAGGTAGAAGACATTCAGATGCACAACTACCAGCAACACAGCCACCTGCCCCCCCAGTCTGAGGAGATGATGCCGCACTCCGGGTCGGTTTACTACAAGCCCTCCTCGCCCCCGACGCCCACCACCCCGGGCTTCCAGGTGCAGCACAGCCCCATGTGGGACGACCCGGGATCTCTCCACAACTTCCACCAGAACTACGTGGCCACTACGCACATGATCGAGCAGAGGAAAACGCCAGTCTCCCGCCTCTCCCTCTTCTCCTTTAAGCAATCGCCCCCTGGCACCCCGGTGTCTAGTTGCCAGATGCGCTTCGACGGGCCCCTGCACGTCCCCATGAACCCGGAGCCCGCCGGCAGCCACCACGTGGTGGACGGGCAGACCTTCGCTGTGCCCAACCCCATTCGCAAGCCCGCGTCCATGGGCTTCCCGGGCCTGCAGATCGGCCACGCGTCTCAGCTGCTCGACACGCAGGTGCCCTCACCGCCGTCGCGGGGCTCCCCCTCCAACGAGGGGCTGTGCGCTGTGTGTGGGGACAACGCGGCCTGCCAACACTACGGCGTGCGCACCTGTGAGGGCTGCAAAGGCTTCTTTAAGCGCACAGTGCAAAAAAATGCAAAATACGTGTGTTTAGCAAATAAAAACTGCCCAGTGGACAAGCGTCGCCGGAATCGCTGTCAGTACTGCCGATTTCAGAAGTGCCTGGCTGTTGGGATGGTCAAAGAAGTGGTTCGCACAGACAGTTTAAAAGGCCGGAGAGGTCGTTTGCCCTCGAAACCGAAGAGCCCACAGGAGCCCTCTCCCCCTTCGCCCCCGGTGAGTCTGATCAGTGCCCTCGTCAGGGCCCATGTCGACTCCAACCCGGCTATGACCAGCCTGGACTATTCCAGGTTCCAGGCGAACCCTGACTATCAAATGAGTGGAGATGACACCCAGCATATCCAGCAATTCTATGATCTCCTGACTGGCTCCATGGAGATCATCCGGGGCTGGGCAGAGAAGATCCCTGGCTTCGCAGACCTGCCCAAAGCCGACCAAGACCTGCTTTTTGAATCAGCTTTCTTAGAACTGTTTGTCCTTCGATTAGCATACAGGTCCAACCCAGTGGAGGGTAAACTCATCTTTTGCAATGGGGTGGTCTTGCACAGGTTGCAATGCGTTCGTGGCTTTGGGGAATGGATTGATTCCATTGTTGAATTCTCCTCCAACTTGCAGAATATGAACATCGACATTTCTGCCTTCTCCTGCATTGCTGCCCTGGCTATGGTCACAGAGAGACACGGGCTCAAGGAACCCAAGAGAGTGGAAGAACTGCAAAACAAGATTGTAAATTGTCTCAAAGACCACGTGACTTTCAACAATGGGGGGTTGAACCGCCCCAATTATTTGTCCAAACTGTTGGGGAAGCTCCCAGAACTTCGTACCCTTTGCACACAGGGGCTACAGCGCATTTTCTACCTGAAATTGGAAGACTTGGTGCCACCGCCAGCAATAATTGACAAACTTTTCCTGGACACTTTACCTTTCTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T67163-Ab Anti-NR4A2 monoclonal antibody
    Target Antigen GM-Tg-g-T67163-Ag NR4A2 protein
    ORF Viral Vector pGMLV000901 Human NR4A2 Lentivirus plasmid
    ORF Viral Vector pGMAD000193 Human NR4A2 Adenovirus plasmid
    ORF Viral Vector vGMLV000901 Human NR4A2 Lentivirus particle
    ORF Viral Vector vGMAD000193 Human NR4A2 Adenovirus particle


    Target information

    Target ID GM-T67163
    Target Name NR4A2
    Gene ID 4929, 18227, 697077, 54278, 101089537, 478754, 540245, 100050666
    Gene Symbol and Synonyms HZF-3,IDLDP,NOT,NR4A2,NURR1,RNR-1,RNR1,TINOR,TINUR
    Uniprot Accession P43354
    Uniprot Entry Name NR4A2_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000153234
    Target Classification Tumor-associated antigen (TAA)

    This gene encodes a member of the steroid-thyroid hormone-retinoid receptor superfamily. The encoded protein may act as a transcription factor. Mutations in this gene have been associated with disorders related to dopaminergic dysfunction, including Parkinson disease, schizophernia, and manic depression. Misregulation of this gene may be associated with rheumatoid arthritis. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.