Human CCN2/CTGF/ HCS24 ORF/cDNA clone-Lentivirus particle (NM_001901.4)
Pre-made Human CCN2/CTGF/ HCS24 Lentiviral expression plasmid for CCN2 lentivirus packaging, CCN2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to CTGF/CCN2 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLV001357 | Human CCN2 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLV001357 |
Gene Name | CCN2 |
Accession Number | NM_001901.4 |
Gene ID | 1490 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 1050 bp |
Gene Alias | CTGF, HCS24, IGFBP8, NOV2 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocinmyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGACCGCCGCCAGTATGGGCCCCGTCCGCGTCGCCTTCGTGGTCCTCCTCGCCCTCTGCAGCCGGCCGGCCGTCGGCCAGAACTGCAGCGGGCCGTGCCGGTGCCCGGACGAGCCGGCGCCGCGCTGCCCGGCGGGCGTGAGCCTCGTGCTGGACGGCTGCGGCTGCTGCCGCGTCTGCGCCAAGCAGCTGGGCGAGCTGTGCACCGAGCGCGACCCATGCGACCCGCACAAGGGCCTATTCTGTCACTTCGGCTCCCCGGCCAACCGCAAGATCGGCGTGTGCACCGCCAAAGATGGTGCTCCCTGCATCTTCGGTGGTACGGTGTACCGCAGCGGAGAGTCCTTCCAGAGCAGCTGCAAGTACCAGTGCACGTGCCTGGACGGGGCGGTGGGCTGCATGCCCCTGTGCAGCATGGACGTTCGTCTGCCCAGCCCTGACTGCCCCTTCCCGAGGAGGGTCAAGCTGCCCGGGAAATGCTGCGAGGAGTGGGTGTGTGACGAGCCCAAGGACCAAACCGTGGTTGGGCCTGCCCTCGCGGCTTACCGACTGGAAGACACGTTTGGCCCAGACCCAACTATGATTAGAGCCAACTGCCTGGTCCAGACCACAGAGTGGAGCGCCTGTTCCAAGACCTGTGGGATGGGCATCTCCACCCGGGTTACCAATGACAACGCCTCCTGCAGGCTAGAGAAGCAGAGCCGCCTGTGCATGGTCAGGCCTTGCGAAGCTGACCTGGAAGAGAACATTAAGAAGGGCAAAAAGTGCATCCGTACTCCCAAAATCTCCAAGCCTATCAAGTTTGAGCTTTCTGGCTGCACCAGCATGAAGACATACCGAGCTAAATTCTGTGGAGTATGTACCGACGGCCGATGCTGCACCCCCCACAGAACCACCACCCTGCCGGTGGAGTTCAAGTGCCCTGACGGCGAGGTCATGAAGAAGAACATGATGTTCATCAAGACCTGTGCCTGCCATTACAACTGTCCCGGAGACAATGACATCTTTGAATCGCTGTACTACAGGAAGATGTACGGAGACATGGCATGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Biosimilar | GMP-Bios-ab-424 | Pre-Made Pamrevlumab biosimilar, Whole mAb, Anti-CTGF/CCN2 Antibody: Anti-HCS24/IGFBP8/NOV2 therapeutic antibody |
Target Antibody | GM-Tg-g-T50444-Ab | Anti-CCN2/ CTGF/ HCS24 monoclonal antibody |
Target Antigen | GM-Tg-g-T50444-Ag | CTGF/CCN2 VLP (virus-like particle) |
Cytokine | cks-Tg-g-GM-T50444 | connective tissue growth factor (CTGF) protein & antibody |
ORF Viral Vector | pGMLV001357 | Human CCN2 Lentivirus plasmid |
ORF Viral Vector | pGMAD000129 | Human CCN2 Adenovirus plasmid |
ORF Viral Vector | pGMPC000028 | Human CCN2 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | vGMLV001357 | Human CCN2 Lentivirus particle |
ORF Viral Vector | vGMAD000129 | Human CCN2 Adenovirus particle |
ORF Viral Vector | pGMLV002243 | Human CCN2 Lentivirus plasmid |
ORF Viral Vector | pGMLV002442 | Human CCN2 Lentivirus plasmid |
Target information
Target ID | GM-T50444 |
Target Name | CTGF |
Gene ID | 1490, 14219, 714520, 64032, 101094598, 476202, 281103, 100073098 |
Gene Symbol and Synonyms | CCN2,CTGF,CTGRP,fisp-12,Fisp12,HCS24,IGFBP8,NOV2 |
Uniprot Accession | P29279 |
Uniprot Entry Name | CCN2_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target, INN Index, Cytokine Target |
Disease | Ovary Cancer, Chronic Kidney Disease, Type 1 diabetes mellitus with diabetic nephropathy, gastric cancer, Complications of kidney transplant |
Gene Ensembl | ENSG00000118523 |
Target Classification | Not Available |
The protein encoded by this gene is a mitogen that is secreted by vascular endothelial cells. The encoded protein plays a role in chondrocyte proliferation and differentiation, cell adhesion in many cell types, and is related to platelet-derived growth factor. Certain polymorphisms in this gene have been linked with a higher incidence of systemic sclerosis. [provided by RefSeq, Nov 2009]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.