Human RHEX/C1orf186 ORF/cDNA clone-Lentivirus particle (NM_001007544.4)

Cat. No.: vGMLV001488

Pre-made Human RHEX/C1orf186 Lentiviral expression plasmid for RHEX lentivirus packaging, RHEX lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to RHEX/C1orf186 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLV001488 Human RHEX Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLV001488
Gene Name RHEX
Accession Number NM_001007544.4
Gene ID 440712
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 519 bp
Gene Alias C1orf186
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCTGACAGAAGTCATGGAGGTCTGGCATGGCTTAGTGATCGCGGTGGTGTCCCTCTTCCTGCAGGCCTGCTTCCTCACCGCCATCAACTACCTGCTCAGCAGGCACATGGCCCACAAGAGTGAACAGATACTGAAAGCGGCCAGTCTCCAGGTTCCCAGGCCCAGCCCTGGCCACCATCATCCACCTGCTGTCAAAGAGATGAAGGAGACTCAGACAGAGAGAGACATCCCAATGTCTGATTCCCTTTACAGGCATGACAGCGACACACCCTCAGATAGCTTGGATAGCTCCTGCAGTTCGCCTCCTGCCTGCCAGGCCACAGAGGATGTGGATTACACACAAGTCGTCTTTTCTGACCCTGGAGAACTAAAAAATGACTCCCCGCTGGACTATGAGAACATAAAGGAAATCACAGATTATGTCAATGTCAATCCAGAAAGACACAAGCCCAGTTTCTGGTATTTTGTCAACCCTGCTCTGTCTGAGCCAGCGGAATATGATCAAGTGGCCATGTGA
ORF Protein Sequence MLTEVMEVWHGLVIAVVSLFLQACFLTAINYLLSRHMAHKSEQILKAASLQVPRPSPGHHHPPAVKEMKETQTERDIPMSDSLYRHDSDTPSDSLDSSCSSPPACQATEDVDYTQVVFSDPGELKNDSPLDYENIKEITDYVNVNPERHKPSFWYFVNPALSEPAEYDQVAM

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP2299-Ab Anti-RHEX/ C1orf186 monoclonal antibody
    Target Antigen GM-Tg-g-MP2299-Ag RHEX VLP (virus-like particle)
    ORF Viral Vector pGMLV001488 Human RHEX Lentivirus plasmid
    ORF Viral Vector vGMLV001488 Human RHEX Lentivirus particle


    Target information

    Target ID GM-MP2299
    Target Name RHEX
    Gene ID 440712, 696291, 101086033, 607341, 616928, 100055210
    Gene Symbol and Synonyms C16H1orf186,C1H1orf186,C1orf186,C38H1orf186,C5H1orf186,CF1H1orf186,RHEX
    Uniprot Accession Q6ZWK4
    Uniprot Entry Name RHEX_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000263961
    Target Classification Not Available

    Enables erythropoietin receptor binding activity. Involved in erythropoietin-mediated signaling pathway and positive regulation of erythrocyte differentiation. Located in plasma membrane. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.