Human PDCD1LG2/B7DC/bA574F11.2 ORF/cDNA clone-Lentivirus particle (NM_025239.4)

Cat. No.: vGMLV001696

Pre-made Human PDCD1LG2/B7DC/bA574F11.2 Lentiviral expression plasmid for PDCD1LG2 lentivirus packaging, PDCD1LG2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to PD-L2/PDCD1LG2/B7DC products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLV001696 Human PDCD1LG2 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLV001696
Gene Name PDCD1LG2
Accession Number NM_025239.4
Gene ID 80380
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 822 bp
Gene Alias B7DC,bA574F11.2,Btdc,CD273,PD-L2,PDCD1L2,PDL2
Fluorescent Reporter Null
Mammalian Cell Selection Puromyocin
Fusion Tag Null
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGATCTTCCTCCTGCTAATGTTGAGCCTGGAATTGCAGCTTCACCAGATAGCAGCTTTATTCACAGTGACAGTCCCTAAGGAACTGTACATAATAGAGCATGGCAGCAATGTGACCCTGGAATGCAACTTTGACACTGGAAGTCATGTGAACCTTGGAGCAATAACAGCCAGTTTGCAAAAGGTGGAAAATGATACATCCCCACACCGTGAAAGAGCCACTTTGCTGGAGGAGCAGCTGCCCCTAGGGAAGGCCTCGTTCCACATACCTCAAGTCCAAGTGAGGGACGAAGGACAGTACCAATGCATAATCATCTATGGGGTCGCCTGGGACTACAAGTACCTGACTCTGAAAGTCAAAGCTTCCTACAGGAAAATAAACACTCACATCCTAAAGGTTCCAGAAACAGATGAGGTAGAGCTCACCTGCCAGGCTACAGGTTATCCTCTGGCAGAAGTATCCTGGCCAAACGTCAGCGTTCCTGCCAACACCAGCCACTCCAGGACCCCTGAAGGCCTCTACCAGGTCACCAGTGTTCTGCGCCTAAAGCCACCCCCTGGCAGAAACTTCAGCTGTGTGTTCTGGAATACTCACGTGAGGGAACTTACTTTGGCCAGCATTGACCTTCAAAGTCAGATGGAACCCAGGACCCATCCAACTTGGCTGCTTCACATTTTCATCCCCTTCTGCATCATTGCTTTCATTTTCATAGCCACAGTGATAGCCCTAAGAAAACAACTCTGTCAAAAGCTGTATTCTTCAAAAGACACAACAAAAAGACCTGTCACCACAACAAAGAGGGAAGTGAACAGTGCTATCTGA
ORF Protein Sequence MIFLLLMLSLELQLHQIAALFTVTVPKELYIIEHGSNVTLECNFDTGSHVNLGAITASLQKVENDTSPHRERATLLEEQLPLGKASFHIPQVQVRDEGQYQCIIIYGVAWDYKYLTLKVKASYRKINTHILKVPETDEVELTCQATGYPLAEVSWPNVSVPANTSHSRTPEGLYQVTSVLRLKPPPGRNFSCVFWNTHVRELTLASIDLQSQMEPRTHPTWLLHIFIPFCIIAFIFIATVIALRKQLCQKLYSSKDTTKRPVTTTKREVNSAI

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T50035-Ab Anti-PD1L2/ PD-L2/ PDCD1LG2 monoclonal antibody
    Target Antigen GM-Tg-g-T50035-Ag PD-L2/PDCD1LG2 VLP (virus-like particle)
    ORF Viral Vector pGMLP003496 Human PDCD1LG2 Lentivirus plasmid
    ORF Viral Vector pGMLV001696 Human PDCD1LG2 Lentivirus plasmid
    ORF Viral Vector vGMLP003496 Human PDCD1LG2 Lentivirus particle
    ORF Viral Vector vGMLV001696 Human PDCD1LG2 Lentivirus particle


    Target information

    Target ID GM-T50035
    Target Name PD-L2
    Gene ID 80380, 58205, 716003, 309304, 101097847, 609699, 539392, 100059542
    Gene Symbol and Synonyms B7-DC,B7DC,bA574F11.2,Btdc,CD273,F730015O22Rik,PCD1LG2,PD-L2,PDCD1L2,PDCD1LG2,PDL2
    Uniprot Accession Q9BQ51
    Uniprot Entry Name PD1L2_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Immuno-oncology Target
    Disease Asthma
    Gene Ensembl ENSG00000197646
    Target Classification Checkpoint-Immuno Oncology

    Involved in negative regulation of activated T cell proliferation; negative regulation of interferon-gamma production; and negative regulation of interleukin-10 production. Predicted to be located in plasma membrane. Predicted to be active in external side of plasma membrane. Biomarker of pulmonary tuberculosis. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.