Human CCR3/C C CKR3/CC-CKR-3 ORF/cDNA clone-Lentivirus particle (NM_178329.3)

Cat. No.: vGMLV001946

Pre-made Human CCR3/C C CKR3/CC-CKR-3 Lentiviral expression plasmid for CCR3 lentivirus packaging, CCR3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to CCR3/C C CKR3 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLV001946 Human CCR3 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLV001946
Gene Name CCR3
Accession Number NM_178329.3
Gene ID 1232
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1068 bp
Gene Alias C C CKR3,CC-CKR-3,CD193,CKR 3,CKR3,CMKBR3
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGACAACCTCACTAGATACAGTTGAGACCTTTGGTACCACATCCTACTATGATGACGTGGGCCTGCTCTGTGAAAAAGCTGATACCAGAGCACTGATGGCCCAGTTTGTGCCCCCGCTGTACTCCCTGGTGTTCACTGTGGGCCTCTTGGGCAATGTGGTGGTGGTGATGATCCTCATAAAATACAGGAGGCTCCGAATTATGACCAACATCTACCTGCTCAACCTGGCCATTTCGGACCTGCTCTTCCTCGTCACCCTTCCATTCTGGATCCACTATGTCAGGGGGCATAACTGGGTTTTTGGCCATGGCATGTGTAAGCTCCTCTCAGGGTTTTATCACACAGGCTTGTACAGCGAGATCTTTTTCATAATCCTGCTGACAATCGACAGGTACCTGGCCATTGTCCATGCTGTGTTTGCCCTTCGAGCCCGGACTGTCACTTTTGGTGTCATCACCAGCATCGTCACCTGGGGCCTGGCAGTGCTAGCAGCTCTTCCTGAATTTATCTTCTATGAGACTGAAGAGTTGTTTGAAGAGACTCTTTGCAGTGCTCTTTACCCAGAGGATACAGTATATAGCTGGAGGCATTTCCACACTCTGAGAATGACCATCTTCTGTCTCGTTCTCCCTCTGCTCGTTATGGCCATCTGCTACACAGGAATCATCAAAACGCTGCTGAGGTGCCCCAGTAAAAAAAAGTACAAGGCCATCCGGCTCATTTTTGTCATCATGGCGGTGTTTTTCATTTTCTGGACACCCTACAATGTGGCTATCCTTCTCTCTTCCTATCAATCCATCTTATTTGGAAATGACTGTGAGCGGAGCAAGCATCTGGACCTGGTCATGCTGGTGACAGAGGTGATCGCCTACTCCCACTGCTGCATGAACCCGGTGATCTACGCCTTTGTTGGAGAGAGGTTCCGGAAGTACCTGCGCCACTTCTTCCACAGGCACTTGCTCATGCACCTGGGCAGATACATCCCATTCCTTCCTAGTGAGAAGCTGGAAAGAACCAGCTCTGTCTCTCCATCCACAGCAGAGCCGGAACTCTCTATTGTGTTTTAG
ORF Protein Sequence MTTSLDTVETFGTTSYYDDVGLLCEKADTRALMAQFVPPLYSLVFTVGLLGNVVVVMILIKYRRLRIMTNIYLLNLAISDLLFLVTLPFWIHYVRGHNWVFGHGMCKLLSGFYHTGLYSEIFFIILLTIDRYLAIVHAVFALRARTVTFGVITSIVTWGLAVLAALPEFIFYETEELFEETLCSALYPEDTVYSWRHFHTLRMTIFCLVLPLLVMAICYTGIIKTLLRCPSKKKYKAIRLIFVIMAVFFIFWTPYNVAILLSSYQSILFGNDCERSKHLDLVMLVTEVIAYSHCCMNPVIYAFVGERFRKYLRHFFHRHLLMHLGRYIPFLPSEKLERTSSVSPSTAEPELSIVF

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T02752-Ab Anti-CCR3/ CC-CKR-3/ CD193 monoclonal antibody
    Target Antigen GM-Tg-g-T02752-Ag CCR3 VLP (virus-like particle)
    Cytokine cks-Tg-g-GM-T02752 chemokine (C-C motif) receptor 3 (CCR3) protein & antibody
    ORF Viral Vector pGMLV001946 Human CCR3 Lentivirus plasmid
    ORF Viral Vector vGMLV001946 Human CCR3 Lentivirus particle


    Target information

    Target ID GM-T02752
    Target Name CCR3
    Gene ID 1232, 12771, 713368, 117027, 100191005, 448802, 408018, 100065437
    Gene Symbol and Synonyms C C CKR3,CC-CKR-3,CC-CKR3,CCR3,CD193,CKR 3,CKR3,Cmkbr1l2,CMKBR3
    Uniprot Accession P51677
    Uniprot Entry Name CCR3_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Cytokine Target
    Disease Not Available
    Gene Ensembl ENSG00000183625
    Target Classification GPCR

    The protein encoded by this gene is a receptor for C-C type chemokines. It belongs to family 1 of the G protein-coupled receptors. This receptor binds and responds to a variety of chemokines, including eotaxin (CCL11), eotaxin-3 (CCL26), MCP-3 (CCL7), MCP-4 (CCL13), and RANTES (CCL5). It is highly expressed in eosinophils and basophils, and is also detected in TH1 and TH2 cells, as well as in airway epithelial cells. This receptor may contribute to the accumulation and activation of eosinophils and other inflammatory cells in the allergic airway. It is also known to be an entry co-receptor for HIV-1. This gene and seven other chemokine receptor genes form a chemokine receptor gene cluster on the chromosomal region 3p21. Alternatively spliced transcript variants have been described. [provided by RefSeq, Sep 2009]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.