Order informatioin


Delivery impact due to the Coronavirus Outbreak

With the COVID-19 outbreak in the world, many flights have been cancelled. In order for the customer to receive the goods properly, we use the FedEx Customized Freight (FCF) of Fedex which demands a higher fee. If the delivery fee is more expensive in your area, we will contact you by mail.

Package Catalog No. Price(In USD) Qty (Quantity) Sum(In USD)
5ug GMV-V-2019nCoV-020 828
Shipping Cost: 760.00
Total:



Description

2019 nCoV related GeneN protein
Species Host2019 nCoV
VectorpCDNA3.1(+)
Reporternull
Antibiotic in Mammalian cellNeomycin / G418
Length1260
PromoterCMV
TagNo tag
Coden Optimizedcoden optimized for mamamlian
Gene Accession NumberQHD43423.2
ApplicationMammalian cells expression
SequencePicture loading failed.Download the map and sequence here and read in Snapgene Software.
Click here to download SnapGene Viewer
ATGAGCGACAACGGCCCTCAGAACCAGCGGAACGCCCCTAGGATTACATTCGGCGGCCCATCTGACTCTACCGGCTCTAACCAGAACGGCGAGCGATCCGGCGCCCGGTCCAAGCAGCGGAGACCTCAGGGCCTGCCAAACAACACAGCCTCTTGGTTCACAGCCCTCACCCAGCACGGCAAGGAGGACCTGAAGTTCCCTAGAGGCCAGGGCGTGCCAATTAACACAAACTCTTCTCCTGACGACCAGATTGGCTACTACAGACGCGCCACACGGAGAATCCGGGGCGGCGACGGCAAGATGAAGGACCTGTCTCCTAGGTGGTACTTCTACTACCTGGGCACCGGCCCCGAGGCCGGCCTCCCATACGGCGCCAACAAGGACGGCATTATTTGGGTGGCCACCGAGGGCGCCCTGAACACCCCAAAGGACCACATTGGCACACGGAACCCTGCCAACAACGCCGCCATCGTGCTACAGCTCCCTCAGGGCACCACACTGCCTAAGGGCTTCTACGCCGAGGGCTCTCGGGGCGGCTCTCAGGCCTCTTCTAGGTCTAGCTCTCGTTCTCGCAACTCTTCCCGGAACTCCACCCCTGGCTCTTCCCGAGGCACATCTCCTGCCCGCATGGCCGGCAACGGCGGCGACGCCGCCCTCGCCCTGCTCCTGCTGGACAGACTGAACCAGCTGGAGTCTAAGATGTCTGGCAAGGGCCAGCAGCAGCAGGGCCAGACCGTGACAAAGAAGTCCGCCGCCGAGGCCTCTAAGAAGCCTAGACAGAAGCGCACAGCCACAAAGGCCTACAACGTGACACAGGCCTTCGGGCGGAGAGGCCCCGAGCAGACACAGGGCAACTTCGGCGACCAGGAGCTGATTAGACAGGGCACCGACTACAAGCACTGGCCTCAGATTGCCCAGTTCGCCCCTAGCGCCTCTGCCTTCTTCGGCATGTCTCGCATTGGCATGGAGGTGACCCCCAGCGGGACGTGGCTCACATACACCGGCGCCATTAAGCTGGACGACAAGGACCCAAACTTCAAGGACCAGGTGATTCTGCTGAACAAGCACATTGACGCCTACAAGACATTCCCACCTACCGAGCCAAAGAAGGACAAGAAGAAGAAGGCCGACGAGACCCAGGCCCTCCCTCAGAGACAGAAGAAGCAGCAGACCGTGACACTGCTCCCCGCCGCCGACCTCGACGACTTCTCTAAGCAGCTTCAGCAGTCCATGTCTTCTGCCGACTCCACCCAGGCCTGA




GENEMEDI
6th Floor, Buiding No.2, Kangxin Road 3377, Shanghai, China
Email: [email protected] [email protected]
Telephone: +86-21-50478399   Fax: 86-21-50478399
Privacy Policy
Chinese Website

COVID-19
related
protocols,
data and
products

COVID-19 related protocols, data and products

×