Order informatioin


Delivery impact due to the Coronavirus Outbreak

With the COVID-19 outbreak in the world, many flights have been cancelled. In order for the customer to receive the goods properly, we use the FedEx Customized Freight (FCF) of Fedex which demands a higher fee. If the delivery fee is more expensive in your area, we will contact you by mail.

Package Catalog No. Price(In USD) Qty (Quantity) Sum(In USD)
5ug GMV-V-2019nCoV-035 828
Shipping Cost: 760.00
Total:



Description

2019 nCoV related GeneSpike(S1+S2)
Species Host2019 nCoV
VectorpET21a
Reporternull
Antibiotic in Mammalian cellNone
Length3822
PromoterT7
TagC-His
Coden Optimizedcoden optimized for E.coli
Gene Accession NumberQHD43416.1
ApplicationE.coli expression, recombinant protein production
SequencePicture loading failed.Download the map and sequence here and read in Snapgene Software.
Click here to download SnapGene Viewer
ATGTTTGTGTTTCTGGTGCTGCTGCCGCTCGTCTCTTCTCAGTGTGTTAATCTGACCACCCGTACCCAGCTGCCGCCGGCATATACCAATAGCTTTACCCGCGGCGTGTATTATCCGGATAAAGTGTTTCGTAGTTCAGTGCTGCATAGCACCCAGGATCTGTTTCTGCCGTTTTTTAGTAATGTTACCTGGTTTCATGCAATTCATGTGAGCGGCACCAATGGTACCAAACGCTTTGATAATCCGGTGCTGCCGTTTAATGATGGCGTGTATTTTGCATCAACCGAAAAATCAAATATTATTCGCGGTTGGATTTTTGGTACCACCCTGGATAGTAAAACCCAGTCACTGCTGATTGTGAATAATGCAACCAATGTGGTTATTAAAGTGTGTGAATTTCAGTTTTGTAATGATCCGTTTCTGGGCGTGTATTATCATAAAAATAATAAATCTTGGATGGAAAGCGAATTTCGCGTGTATAGTAGCGCAAATAATTGTACCTTTGAATATGTGTCACAGCCGTTTCTGATGGATCTGGAAGGTAAACAGGGTAATTTTAAAAATCTGCGCGAATTTGTGTTTAAAAATATTGATGGCTATTTTAAAATTTATAGCAAACATACCCCGATTAATCTGGTGCGCGATCTGCCGCAGGGCTTTAGCGCACTGGAACCGCTGGTTGATCTGCCGATTGGCATTAATATTACCCGCTTTCAGACCCTGCTGGCACTGCATCGCTCTTATCTGACTCCAGGCGATAGCTCAAGCGGTTGGACCGCAGGCGCAGCAGCATATTATGTTGGCTATCTCCAGCCGCGTACCTTTCTGCTGAAATATAATGAAAATGGTACCATTACCGATGCAGTTGATTGTGCACTTGACCCTTTATCTGAAACCAAATGTACCCTGAAATCATTTACCGTGGAAAAAGGCATTTATCAGACCTCTAATTTTCGCGTTCAGCCGACCGAAAGCATTGTTCGCTTTCCGAATATTACCAATCTGTGTCCGTTTGGCGAAGTGTTTAATGCAACCCGCTTTGCAAGCGTGTATGCATGGAATCGTAAACGTATTAGCAATTGTGTTGCAGATTATAGCGTGCTGTATAATAGCGCATCATTTTCAACCTTTAAATGTTATGGCGTTAGTCCGACCAAACTGAATGATCTGTGTTTTACCAATGTGTATGCAGATAGCTTTGTTATTCGCGGCGATGAAGTGCGCCAGATTGCACCGGGCCAGACCGGCAAAATTGCAGATTATAATTATAAACTGCCGGATGATTTTACCGGCTGTGTTATTGCATGGAATAGTAATAATCTGGATTCTAAAGTGGGTGGTAATTATAATTATCTGTATCGCCTGTTTCGTAAAAGCAATCTGAAACCGTTTGAACGCGATATTTCAACCGAAATTTATCAGGCAGGCTCAACCCCGTGTAATGGCGTGGAAGGCTTTAATTGTTATTTTCCGCTTCAGAGCTATGGCTTTCAGCCGACCAATGGCGTGGGCTATCAGCCGTATCGCGTGGTGGTGCTGTCATTTGAACTGCTCCATGCACCGGCAACCGTTTGTGGTCCGAAAAAATCAACCAATCTGGTGAAAAATAAATGTGTGAATTTTAATTTTAATGGCCTGACCGGTACCGGCGTGCTGACCGAATCAAATAAAAAATTTCTGCCGTTTCAGCAGTTTGGTCGCGATATTGCAGATACCACCGATGCAGTTCGCGATCCGCAGACCCTGGAAATTCTGGATATTACCCCGTGTAGCTTTGGCGGCGTGAGTGTTATTACGCCTGGTACCAATACCTCTAATCAGGTGGCAGTGCTGTATCAGGATGTGAATTGTACCGAAGTTCCGGTGGCAATTCATGCAGATCAGCTGACCCCGACCTGGCGCGTGTATAGCACCGGCTCTAATGTGTTTCAGACCCGCGCAGGTTGTCTGATTGGCGCAGAACATGTGAATAATAGCTATGAATGTGATATTCCGATTGGCGCAGGCATTTGTGCAAGCTATCAGACCCAGACCAATAGTCCGCGTCGCGCACGCTCAGTGGCATCACAGTCTATTATTGCATATACCATGAGCCTGGGCGCAGAAAATTCAGTTGCATATAGTAATAATTCTATTGCAATTCCGACCAATTTTACCATTAGCGTGACCACCGAAATTCTGCCGGTTAGTATGACCAAAACCTCAGTTGATTGTACCATGTATATTTGTGGCGATTCAACCGAATGTAGTAATCTGCTGCTACAATATGGTAGCTTTTGTACCCAGCTGAATCGCGCACTGACCGGCATTGCAGTGGAACAGGATAAAAATACCCAGGAAGTGTTTGCACAGGTTAAACAGATTTATAAAACCCCGCCGATTAAAGATTTTGGTGGCTTTAATTTTAGCCAGATTCTGCCGGACCCGTCTAAACCGTCTAAACGCTCATTTATTGAGGACCTGCTGTTTAATAAAGTGACCCTGGCAGATGCAGGCTTTATTAAACAGTATGGTGATTGTCTGGGCGATATTGCAGCACGCGATCTGATTTGTGCACAGAAATTTAATGGCCTGACCGTTCTGCCGCCGCTGCTGACCGATGAAATGATTGCACAGTATACCTCAGCACTGCTGGCAGGTACCATTACCAGCGGTTGGACCTTTGGCGCAGGCGCAGCACTACAGATTCCGTTTGCAATGCAGATGGCATATCGCTTTAATGGCATTGGCGTTACCCAGAATGTTCTGTATGAAAATCAGAAACTGATTGCAAATCAGTTTAATAGCGCAATTGGTAAAATTCAGGATAGCCTGTCTTCAACCGCAAGCGCACTGGGTAAACTTCAAGATGTGGTGAATCAGAATGCACAGGCACTGAATACCCTGGTTAAACAGCTGTCAAGCAATTTTGGCGCAATTAGTAGCGTGCTGAATGATATTCTGTCACGCCTGGATAAAGTGGAAGCAGAAGTTCAGATTGATCGCCTGATTACCGGTCGCCTCCAGTCACTTCAAACCTATGTGACCCAGCAGCTGATTCGCGCAGCAGAAATTCGCGCAAGCGCAAATCTGGCAGCAACCAAAATGAGCGAATGTGTTCTGGGCCAGTCTAAGCGAGTTGATTTTTGTGGTAAAGGCTATCATCTGATGAGCTTTCCGCAGTCAGCACCGCATGGCGTGGTTTTTCTGCATGTGACCTATGTTCCGGCACAGGAAAAAAATTTTACCACCGCACCGGCAATTTGTCATGATGGTAAAGCACATTTTCCGCGCGAAGGCGTGTTTGTGAGTAATGGCACCCATTGGTTTGTGACCCAGCGTAATTTTTATGAACCGCAGATTATTACCACCGATAATACCTTTGTGAGCGGTAATTGTGATGTGGTTATTGGCATTGTTAATAATACCGTTTATGATCCGTTACAGCCGGAACTGGATAGCTTTAAAGAAGAACTGGATAAATATTTTAAAAATCATACCTCTCCGGATGTTGATCTGGGCGATATTAGCGGCATTAATGCAAGCGTGGTGAATATTCAGAAAGAAATTGATCGTCTGAATGAAGTTGCAAAAAATCTGAATGAAAGCCTGATTGATCTACAAGAACTGGGCAAATATGAACAGTATATTAAATGGCCGTGGTATATTTGGCTGGGCTTTATTGCAGGCCTGATTGCAATTGTTATGGTGACCATTATGCTGTGTTGTATGACCTCTTGTTGTTCTTGTCTGAAAGGTTGTTGTAGTTGTGGCTCTTGTTGTAAATTTGATGAAGATGATAGCGAACCGGTGCTGAAAGGCGTTAAACTGCATTATACC




GENEMEDI
6th Floor, Buiding No.2, Kangxin Road 3377, Shanghai, China
Email: [email protected] [email protected]
Telephone: +86-21-50478399   Fax: 86-21-50478399
Privacy Policy
Chinese Website

COVID-19
related
protocols,
data and
products

COVID-19 related protocols, data and products

×