Human IL4/BCGF-1/ BCGF1 ORF/cDNA clone-Adenovirus plasmid (NM_000589)

Pre-made Human IL4/BCGF-1/ BCGF1 adenoviral expression plasmid for IL4 adenovirus packaging, IL4 adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.

Target products collectionGo to IL4/BCGF-1 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMAP-IL-090 Human IL4 Adenovirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMAP-IL-090
Gene Name IL4
Accession Number NM_000589
Gene ID 3565
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 462 bp
Gene Alias BCGF-1, BCGF1, BSF-1, BSF1, IL-4
Fluorescent Reporter EGFP
Mammalian Cell Selection
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGGTCTCACCTCCCAACTGCTTCCCCCTCTGTTCTTCCTGCTAGCATGTGCCGGCAACTTTGTCCACGGACACAAGTGCGATATCACCTTACAGGAGATCATCAAAACTTTGAACAGCCTCACAGAGCAGAAGACTCTGTGCACCGAGTTGACCGTAACAGACATCTTTGCTGCCTCCAAGAACACAACTGAGAAGGAAACCTTCTGCAGGGCTGCGACTGTGCTCCGGCAGTTCTACAGCCACCATGAGAAGGACACTCGCTGCCTGGGTGCGACTGCACAGCAGTTCCACAGGCACAAGCAGCTGATCCGATTCCTGAAACGGCTCGACAGGAACCTCTGGGGCCTGGCGGGCTTGAATTCCTGTCCTGTGAAGGAAGCCAACCAGAGTACGTTGGAAAACTTCTTGGAAAGGCTAAAGACGATCATGAGAGAGAAATATTCAAAGTGTTCGAGCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-INN-945 Pre-Made Pascolizumab Biosimilar, Whole Mab, Anti-Il4 Antibody: Anti-BCGF-1/BCGF1/BSF-1/BSF1/IL-4 therapeutic antibody
    Biosimilar GMP-Bios-ab-492 Pre-Made Romilkimab biosimilar, Bispecific Dual Variable Domain IG, Anti-IL13;IL4 Antibody: Anti-IL-13/P600;BCGF-1/BCGF1/BSF-1/BSF1/IL-4 therapeutic antibody
    Target Antibody GM-Tg-g-T00239-Ab Anti-IL4/ BCGF-1/ BCGF1 functional antibody
    Target Antigen GM-Tg-g-T00239-Ag IL4 protein
    ORF Viral Vector pGMAAV000365 Human IL4 Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMPC000614 Human IL4 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMLP004452 Human IL4 Lentivirus plasmid
    ORF Viral Vector pGMLP-IL-007 Human IL4 Lentivirus plasmid
    ORF Viral Vector pGMAP-IL-090 Human IL4 Adenovirus plasmid
    ORF Viral Vector vGMAAV000365 Human IL4 Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMLP004452 Human IL4 Lentivirus particle
    ORF Viral Vector vGMLP-IL-007 Human IL4 Lentivirus particle
    ORF Viral Vector vGMAP-IL-090 Human IL4 Adenovirus particle
    ORF Viral Vector pGMLV002384 Mouse Il4 Lentivirus plasmid


    Target information

    Target ID GM-T00239
    Target Name IL4
    Gene ID 3565, 16189, 574281, 287287, 751514, 403785, 280824, 100034225
    Gene Symbol and Synonyms BCGF-1,BCGF1,BSF-1,BSF1,IL-4,IL4,Il4e12
    Uniprot Accession P05112
    Uniprot Entry Name IL4_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, INN Index
    Disease Breast Cancer
    Gene Ensembl ENSG00000113520
    Target Classification Not Available

    The protein encoded by this gene is a pleiotropic cytokine produced by activated T cells. This cytokine is a ligand for interleukin 4 receptor. The interleukin 4 receptor also binds to IL13, which may contribute to many overlapping functions of this cytokine and IL13. STAT6, a signal transducer and activator of transcription, has been shown to play a central role in mediating the immune regulatory signal of this cytokine. This gene, IL3, IL5, IL13, and CSF2 form a cytokine gene cluster on chromosome 5q, with this gene particularly close to IL13. This gene, IL13 and IL5 are found to be regulated coordinately by several long-range regulatory elements in an over 120 kilobase range on the chromosome. IL4 is considered an important cytokine for tissue repair, counterbalancing the effects of proinflammatory type 1 cytokines, however, it also promotes allergic airway inflammation. Moreover, IL-4, a type 2 cytokine, mediates and regulates a variety of human host responses such as allergic, anti-parasitic, wound healing, and acute inflammation. This cytokine has been reported to promote resolution of neutrophil-mediated acute lung injury. In an allergic response, IL-4 has an essential role in the production of allergen-specific immunoglobin (Ig) E. This pro-inflammatory cytokine has been observed to be increased in COVID-19 (Coronavirus disease 2019) patients, but is not necessarily associated with severe COVID-19 pathology. Two alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, Aug 2020]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.