Human IL4/BCGF-1/ BCGF1 ORF/cDNA clone-Lentivirus particle (NM_000589.3)
Pre-made Human IL4/BCGF-1/ BCGF1 Lentiviral expression plasmid for IL4 lentivirus packaging, IL4 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to IL4/BCGF-1 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP004452 | Human IL4 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP004452 |
Gene Name | IL4 |
Accession Number | NM_000589.3 |
Gene ID | 3565 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 462 bp |
Gene Alias | BCGF-1, BCGF1, BSF-1, BSF1, IL-4 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGGTCTCACCTCCCAACTGCTTCCCCCTCTGTTCTTCCTGCTAGCATGTGCCGGCAACTTTGTCCACGGACACAAGTGCGATATCACCTTACAGGAGATCATCAAAACTTTGAACAGCCTCACAGAGCAGAAGACTCTGTGCACCGAGTTGACCGTAACAGACATCTTTGCTGCCTCCAAGAACACAACTGAGAAGGAAACCTTCTGCAGGGCTGCGACTGTGCTCCGGCAGTTCTACAGCCACCATGAGAAGGACACTCGCTGCCTGGGTGCGACTGCACAGCAGTTCCACAGGCACAAGCAGCTGATCCGATTCCTGAAACGGCTCGACAGGAACCTCTGGGGCCTGGCGGGCTTGAATTCCTGTCCTGTGAAGGAAGCCAACCAGAGTACGTTGGAAAACTTCTTGGAAAGGCTAAAGACGATCATGAGAGAGAAATATTCAAAGTGTTCGAGCTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Target information
Target ID | GM-T00239 |
Target Name | IL4 |
Gene ID | 3565, 16189, 574281, 287287, 751514, 403785, 280824, 100034225 |
Gene Symbol and Synonyms | BCGF-1,BCGF1,BSF-1,BSF1,IL-4,IL4,Il4e12 |
Uniprot Accession | P05112 |
Uniprot Entry Name | IL4_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target, INN Index |
Disease | Breast Cancer |
Gene Ensembl | ENSG00000113520 |
Target Classification | Not Available |
The protein encoded by this gene is a pleiotropic cytokine produced by activated T cells. This cytokine is a ligand for interleukin 4 receptor. The interleukin 4 receptor also binds to IL13, which may contribute to many overlapping functions of this cytokine and IL13. STAT6, a signal transducer and activator of transcription, has been shown to play a central role in mediating the immune regulatory signal of this cytokine. This gene, IL3, IL5, IL13, and CSF2 form a cytokine gene cluster on chromosome 5q, with this gene particularly close to IL13. This gene, IL13 and IL5 are found to be regulated coordinately by several long-range regulatory elements in an over 120 kilobase range on the chromosome. IL4 is considered an important cytokine for tissue repair, counterbalancing the effects of proinflammatory type 1 cytokines, however, it also promotes allergic airway inflammation. Moreover, IL-4, a type 2 cytokine, mediates and regulates a variety of human host responses such as allergic, anti-parasitic, wound healing, and acute inflammation. This cytokine has been reported to promote resolution of neutrophil-mediated acute lung injury. In an allergic response, IL-4 has an essential role in the production of allergen-specific immunoglobin (Ig) E. This pro-inflammatory cytokine has been observed to be increased in COVID-19 (Coronavirus disease 2019) patients, but is not necessarily associated with severe COVID-19 pathology. Two alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, Aug 2020]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.