Human IL13/IL-13/P600 ORF/cDNA clone-Adenovirus plasmid (NM_002188)
Cat. No.: pGMAP-IL-100
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human IL13/IL-13/P600 adenoviral expression plasmid for IL13 adenovirus packaging, IL13 adenovirus.
Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.
Go to
IL13/IL-13 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
| Catalog ID | pGMAP-IL-100 |
| Gene Name | IL13 |
| Accession Number | NM_002188 |
| Gene ID | 3596 |
| Species | Human |
| Product Type | Adenovirus plasmid (overexpression) |
| Insert Length | 441 bp |
| Gene Alias | IL-13,P600 |
| Fluorescent Reporter | EGFP |
| Mammalian Cell Selection | Null |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | EF1 |
| Resistance | Kanamycin |
| ORF Nucleotide Sequence | ATGCATCCGCTCCTCAATCCTCTCCTGTTGGCACTGGGCCTCATGGCGCTTTTGTTGACCACGGTCATTGCTCTCACTTGCCTTGGCGGCTTTGCCTCCCCAGGCCCTGTGCCTCCCTCTACAGCCCTCAGGGAGCTCATTGAGGAGCTGGTCAACATCACCCAGAACCAGAAGGCTCCGCTCTGCAATGGCAGCATGGTATGGAGCATCAACCTGACAGCTGGCATGTACTGTGCAGCCCTGGAATCCCTGATCAACGTGTCAGGCTGCAGTGCCATCGAGAAGACCCAGAGGATGCTGAGCGGATTCTGCCCGCACAAGGTCTCAGCTGGGCAGTTTTCCAGCTTGCATGTCCGAGACACCAAAATCGAGGTGGCCCAGTTTGTAAAGGACCTGCTCTTACATTTAAAGAAACTTTTTCGCGAGGGACAGTTCAACTGA |
| ORF Protein Sequence | MHPLLNPLLLALGLMALLLTTVIALTCLGGFASPGPVPPSTALRELIEELVNITQNQKAPLCNGSMVWSINLTAGMYCAALESLINVSGCSAIEKTQRMLSGFCPHKVSAGQFSSLHVRDTKIEVAQFVKDLLLHLKKLFREGQFN |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Target information
| Target ID | GM-T29143 |
| Target Name | IL13 |
| Gene ID | 3596, 16163, 574325, 116553, 101084678, 442990, 281247, 100034113 |
| Gene Symbol and Synonyms | IL-13,IL13,P600 |
| Uniprot Accession | P35225 |
| Uniprot Entry Name | IL13_HUMAN |
| Protein Sub-location | Secreted Protein/Potential Cytokines |
| Category | Therapeutics Target, Immuno-oncology Target, INN Index |
| Disease | Breast Cancer, asthma, Malignant neoplasm of bladder |
| Gene Ensembl | ENSG00000169194 |
| Target Classification | Checkpoint-Immuno Oncology |
This gene encodes an immunoregulatory cytokine produced primarily by activated Th2 cells. This cytokine is involved in several stages of B-cell maturation and differentiation. It up-regulates CD23 and MHC class II expression, and promotes IgE isotype switching of B cells. This cytokine down-regulates macrophage activity, thereby inhibits the production of pro-inflammatory cytokines and chemokines. This cytokine is found to be critical to the pathogenesis of allergen-induced asthma but operates through mechanisms independent of IgE and eosinophils. This gene, IL3, IL5, IL4, and CSF2 form a cytokine gene cluster on chromosome 5q, with this gene particularly close to IL4. [provided by RefSeq, Jul 2008]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


