Human IL13/ALRH/BHR1 ORF/cDNA clone-Adenovirus particle (BC096139)

Cat. No.: vGMAP000460

Pre-made Human IL13/ALRH/BHR1 Adenovirus for IL13 overexpression in-vitro and in-vivo. The IL13 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified IL13-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collection

Go to IL13/ALRH products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAP000460 Human IL13 Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAP000460
Gene Name IL13
Accession Number BC096139
Gene ID 3596
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 441 bp
Gene Alias ALRH,BHR1,IL-13,P600
Fluorescent Reporter GFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Amplicin
ORF Nucleotide Sequence ATGCATCCGCTCCTCAATCCTCTCCTGTTGGCACTGGGCCTCATGGCGCTTTTGTTGACCACGGTCATTGCTCTCACTTGCCTTGGCGGCTTTGCCTCCCCAGGCCCTGTGCCTCCCTCTACAGCCCTCAGGGAGCTCATTGAGGAGCTGGTCAACATCACCCAGAACCAGAAGGCTCCGCTCTGCAATGGCAGCATGGTATGGAGCATCAACCTGACAGCTGGCATGTACTGTGCAGCCCTGGAATCCCTGATCAACGTGTCAGGCTGCAGTGCCATCGAGAAGACCCAGAGGATGCTGAGCGGATTCTGCCCGCACAAGGTCTCAGCTGGGCAGTTTTCCAGCTTGCATGTCCGAGACACCAAAATCGAGGTGGCCCAGTTTGTAAAGGACCTGCTCTTACATTTAAAGAAACTTTTTCGCGAGGGACAGTTCAACTGA
ORF Protein Sequence MHPLLNPLLLALGLMALLLTTVIALTCLGGFASPGPVPPSTALRELIEELVNITQNQKAPLCNGSMVWSINLTAGMYCAALESLINVSGCSAIEKTQRMLSGFCPHKVSAGQFSSLHVRDTKIEVAQFVKDLLLHLKKLFREGQFN

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-ab-098 Pre-Made Cendakimab biosimilar, Whole mAb, Anti-IL13 Antibody: Anti-IL-13/P600 therapeutic antibody
    Biosimilar GMP-Bios-ab-136 Pre-Made Dectrekumab biosimilar, Whole mAb, Anti-IL13 Antibody: Anti-IL-13/P600 therapeutic antibody
    Biosimilar GMP-Bios-ab-004 Pre-Made Abrezekimab biosimilar, Fab, Anti-IL13 Antibody: Anti-IL-13/P600 therapeutic antibody
    Biosimilar GMP-Bios-ab-592 Pre-Made Tralokinumab biosimilar, Whole mAb, Anti-IL13 Antibody: Anti-IL-13/P600 therapeutic antibody
    Biosimilar GMP-Bios-ab-199 Pre-Made Etokimab biosimilar, Whole mAb, Anti-IL13 Antibody: Anti-IL-13/P600 therapeutic antibody
    Biosimilar GMP-Bios-ab-492 Pre-Made Romilkimab biosimilar, Bispecific Dual Variable Domain IG, Anti-IL13;IL4 Antibody: Anti-IL-13/P600;BCGF-1/BCGF1/BSF-1/BSF1/IL-4 therapeutic antibody
    Biosimilar GMP-Bios-ab-027 Pre-Made Anrukinzumab biosimilar, Whole mAb, Anti-IL13 Antibody: Anti-IL-13/P600 therapeutic antibody
    Biosimilar GMP-Bios-ab-299 Pre-Made Lebrikizumab biosimilar, Whole mAb, Anti-IL13 Antibody: Anti-IL-13/P600 therapeutic antibody
    Target Antibody GM-Tg-g-T29143-Ab Anti-IL13/ IL-13/ P600 functional antibody
    Target Antigen GM-Tg-g-T29143-Ag IL13 protein
    ORF Viral Vector pGMLP000547 Human IL13 Lentivirus plasmid
    ORF Viral Vector pGMAP000460 Human IL13 Adenovirus plasmid
    ORF Viral Vector pGMLP-IL-017 Human IL13 Lentivirus plasmid
    ORF Viral Vector pGMAP-IL-100 Human IL13 Adenovirus plasmid
    ORF Viral Vector vGMLP000547 Human IL13 Lentivirus particle
    ORF Viral Vector vGMAP000460 Human IL13 Adenovirus particle
    ORF Viral Vector vGMLP-IL-017 Human IL13 Lentivirus particle
    ORF Viral Vector vGMAP-IL-100 Human IL13 Adenovirus particle


    Target information

    Target ID GM-T29143
    Target Name IL13
    Gene ID 3596, 16163, 574325, 116553, 101084678, 442990, 281247, 100034113
    Gene Symbol and Synonyms IL-13,IL13,P600
    Uniprot Accession P35225
    Uniprot Entry Name IL13_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, Immuno-oncology Target, INN Index
    Disease Breast Cancer, asthma, Malignant neoplasm of bladder
    Gene Ensembl ENSG00000169194
    Target Classification Checkpoint-Immuno Oncology

    This gene encodes an immunoregulatory cytokine produced primarily by activated Th2 cells. This cytokine is involved in several stages of B-cell maturation and differentiation. It up-regulates CD23 and MHC class II expression, and promotes IgE isotype switching of B cells. This cytokine down-regulates macrophage activity, thereby inhibits the production of pro-inflammatory cytokines and chemokines. This cytokine is found to be critical to the pathogenesis of allergen-induced asthma but operates through mechanisms independent of IgE and eosinophils. This gene, IL3, IL5, IL4, and CSF2 form a cytokine gene cluster on chromosome 5q, with this gene particularly close to IL4. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.