Human DCN/CSCD/DSPG2 ORF/cDNA clone-Adenovirus plasmid (BC005322)
Cat. No.: pGMAP000037
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human DCN/CSCD/DSPG2 adenoviral expression plasmid for DCN adenovirus packaging, DCN adenovirus.
Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.
Go to
DCN/CSCD products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
| Catalog ID | pGMAP000037 |
| Gene Name | DCN |
| Accession Number | BC005322 |
| Gene ID | 1634 |
| Species | Human |
| Product Type | Adenovirus plasmid (overexpression) |
| Insert Length | 1080 bp |
| Gene Alias | CSCD,DSPG2,PG40,PGII,PGS2,SLRR1B |
| Fluorescent Reporter | GFP |
| Mammalian Cell Selection | Null |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | EF1 |
| Resistance | Kanamycin |
| ORF Nucleotide Sequence | ATGAAGGCCACTATCATCCTCCTTCTGCTTGCACAAGTTTCCTGGGCTGGACCGTTTCAACAGAGAGGCTTATTTGACTTTATGCTAGAAGATGAGGCTTCTGGGATAGGCCCAGAAGTTCCTGATGACCGCGACTTCGAGCCCTCCCTAGGCCCAGTGTGCCCCTTCCGCTGTCAATGCCATCTTCGAGTGGTCCAGTGTTCTGATTTGGGTCTGGACAAAGTGCCAAAGGATCTTCCCCCTGACACAACTCTGCTAGACCTGCAAAACAACAAAATAACCGAAATCAAAGATGGAGACTTTAAGAACCTGAAGAACCTTCACGCATTGATTCTTGTCAACAATAAAATTAGCAAAGTTAGTCCTGGAGCATTTACACCTTTGGTGAAGTTGGAACGACTTTATCTGTCCAAGAATCAGCTGAAGGAATTGCCAGAAAAAATGCCCAAAACTCTTCAGGAGCTGCGTGCCCATGAGAATGAGATCACCAAAGTGCGAAAAGTTACTTTCAATGGACTGAACCAGATGATTGTCATAGAACTGGGCACCAATCCGCTGAAGAGCTCAGGAATTGAAAATGGGGCTTTCCAGGGAATGAAGAAGCTCTCCTACATCCGCATTGCTGATACCAATATCACCAGCATTCCTCAAGGTCTTCCTCCTTCCCTTACGGAATTACATCTTGATGGCAACAAAATCAGCAGAGTTGATGCAGCTAGCCTGAAAGGACTGAATAATTTGGCTAAGTTGGGATTGAGTTTCAACAGCATCTCTGCTGTTGACAATGGCTCTCTGGCCAACACGCCTCATCTGAGGGAGCTTCACTTGGACAACAACAAGCTTACCAGAGTACCTGGTGGGCTGGCAGAGCATAAGTACATCCAGGTTGTCTACCTTCATAACAACAATATCTCTGTAGTTGGATCAAGTGACTTCTGCCCACCTGGACACAACACCAAAAAGGCTTCTTATTCGGGTGTGAGTCTTTTCAGCAACCCGGTCCAGTACTGGGAGATACAGCCATCCACCTTCAGATGTGTCTACGTGCGCTCTGCCATTCAACTCGGAAACTATAAGTAA |
| ORF Protein Sequence | MKATIILLLLAQVSWAGPFQQRGLFDFMLEDEASGIGPEVPDDRDFEPSLGPVCPFRCQCHLRVVQCSDLGLDKVPKDLPPDTTLLDLQNNKITEIKDGDFKNLKNLHALILVNNKISKVSPGAFTPLVKLERLYLSKNQLKELPEKMPKTLQELRAHENEITKVRKVTFNGLNQMIVIELGTNPLKSSGIENGAFQGMKKLSYIRIADTNITSIPQGLPPSLTELHLDGNKISRVDAASLKGLNNLAKLGLSFNSISAVDNGSLANTPHLRELHLDNNKLTRVPGGLAEHKYIQVVYLHNNNISVVGSSDFCPPGHNTKKASYSGVSLFSNPVQYWEIQPSTFRCVYVRSAIQLGNYK |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-T67883-Ab | Anti-PGS2/ DCN/ CSCD functional antibody |
| Target Antigen | GM-Tg-g-T67883-Ag | DCN protein |
| ORF Viral Vector | pGMLP001350 | Human DCN Lentivirus plasmid |
| ORF Viral Vector | pGMLV002337 | Human DCN Lentivirus plasmid |
| ORF Viral Vector | pGMAD000132 | Human DCN Adenovirus plasmid |
| ORF Viral Vector | pGMAP000037 | Human DCN Adenovirus plasmid |
| ORF Viral Vector | pGMPC000591 | Human DCN Mammalian (Non-Viral Vector) plasmid |
| ORF Viral Vector | vGMLP001350 | Human DCN Lentivirus particle |
| ORF Viral Vector | vGMLV002337 | Human DCN Lentivirus particle |
| ORF Viral Vector | vGMAD000132 | Human DCN Adenovirus particle |
| ORF Viral Vector | vGMAP000037 | Human DCN Adenovirus particle |
Target information
| Target ID | GM-T67883 |
| Target Name | DCN |
| Gene ID | 1634, 13179, 709933, 29139, 101101236, 403904, 280760, 100034120 |
| Gene Symbol and Synonyms | CSCD,DC,DCN,DSPG2,PG40,PGII,PGS2,SLRR1B |
| Uniprot Accession | P07585 |
| Uniprot Entry Name | PGS2_HUMAN |
| Protein Sub-location | Secreted Protein/Potential Cytokines |
| Category | Therapeutics Target |
| Disease | Not Available |
| Gene Ensembl | ENSG00000011465 |
| Target Classification | Not Available |
This gene encodes a member of the small leucine-rich proteoglycan family of proteins. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate the mature protein. This protein plays a role in collagen fibril assembly. Binding of this protein to multiple cell surface receptors mediates its role in tumor suppression, including a stimulatory effect on autophagy and inflammation and an inhibitory effect on angiogenesis and tumorigenesis. This gene and the related gene biglycan are thought to be the result of a gene duplication. Mutations in this gene are associated with congenital stromal corneal dystrophy in human patients. [provided by RefSeq, Nov 2015]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


