Human PPIA/CYPA/ CYPH ORF/cDNA clone-Adenovirus plasmid (BC000689)

Pre-made Human PPIA/CYPA/ CYPH adenoviral expression plasmid for PPIA adenovirus packaging, PPIA adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.

Target products collectionGo to PPIA/CYPA products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMAP000039 Human PPIA Adenovirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMAP000039
Gene Name PPIA
Accession Number BC000689
Gene ID 5478
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 498 bp
Gene Alias CYPA, CYPH, MGC12404
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGTCAACCCCACCGTGTTCTTCGACATTGCCGTCGACGGCGAGCCCTTGGGCCGCGTCTCCTTTGAGCTGTTTGCAGACAAGGTCCCAAAGACAGCAGAAAATTTTCGTGCTCTGAGCACTGGAGAGAAAGGATTTGGTTATAAGGGTTCCTGCTTTCACAGAATTATTCCAGGGTTTATGTGTCAGGGTGGTGACTTCACACGCCATAATGGCACTGGTGGCAAGTCCATCTATGGGGAGAAATTTGAAGATGAGAACTTCATCCTAAAGCATACGGGTCCTGGCATCTTGTCCATGGCAAATGCTGGACCCAACACAAATGGTTCCCAGTTTTTCATCTGCACTGCCAAGACTGAGTGGTTGGATGGCAAGCATGTGGTGTTTGGCAAAGTGAAAGAAGGCATGAATATTGTGGAGGCCATGGAGCGCTTTGGGTCCAGGAATGGCAAGACCAGCAAGAAGATCACCATTGCTGACTGTGGACAACTCGAATAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T47081-Ab Anti-PPIA/ CYPA/ CYPH functional antibody
    Target Antigen GM-Tg-g-T47081-Ag PPIA protein
    ORF Viral Vector pGMAD000285 Rat Ppia Adenovirus plasmid
    ORF Viral Vector pGMPC001072 Rat Ppia Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMAP000039 Human PPIA Adenovirus plasmid
    ORF Viral Vector vGMAD000285 Rat Ppia Adenovirus particle
    ORF Viral Vector vGMAP000039 Human PPIA Adenovirus particle
    ORF Viral Vector pGMLV002304 Human PPIA Lentivirus plasmid
    ORF Viral Vector pGMLV002305 Human PPIA Lentivirus plasmid


    Target information

    Target ID GM-T47081
    Target Name PPIA
    Gene ID 5478, 268373, 574102, 25518, 493966, 608151, 281418, 100052020
    Gene Symbol and Synonyms Cphn,CYCA,CyP-18,CyP-A,CYPA,CYPH,HEL-S-69p,MT-ND1,MTND1,NADH1,ND1,p1B15,p31,PPIA,SP18
    Uniprot Accession P62937
    Uniprot Entry Name PPIA_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000196262
    Target Classification Not Available

    This gene encodes a member of the peptidyl-prolyl cis-trans isomerase (PPIase) family. PPIases catalyze the cis-trans isomerization of proline imidic peptide bonds in oligopeptides and accelerate the folding of proteins. The encoded protein is a cyclosporin binding-protein and may play a role in cyclosporin A-mediated immunosuppression. The protein can also interact with several HIV proteins, including p55 gag, Vpr, and capsid protein, and has been shown to be necessary for the formation of infectious HIV virions. Multiple pseudogenes that map to different chromosomes have been reported. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.