Human PPIA/CYPA/ CYPH ORF/cDNA clone-Adenovirus particle (BC000689)
Pre-made Human PPIA/CYPA/ CYPH Adenovirus for PPIA overexpression in-vitro and in-vivo. The PPIA adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified PPIA-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go
to PPIA/CYPA products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
vGMAP000039 | Human PPIA Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
5E+10PFU (1E+10pfu/ml×5ml) | |||
1E+11PFU (1E+10pfu/ml×10ml) | |||
Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMAP000039 |
Gene Name | PPIA |
Accession Number | BC000689 |
Gene ID | 5478 |
Species | Human |
Product Type | Adenovirus particle (overexpression) |
Insert Length | 498 bp |
Gene Alias | CYPA, CYPH, MGC12404 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGTCAACCCCACCGTGTTCTTCGACATTGCCGTCGACGGCGAGCCCTTGGGCCGCGTCTCCTTTGAGCTGTTTGCAGACAAGGTCCCAAAGACAGCAGAAAATTTTCGTGCTCTGAGCACTGGAGAGAAAGGATTTGGTTATAAGGGTTCCTGCTTTCACAGAATTATTCCAGGGTTTATGTGTCAGGGTGGTGACTTCACACGCCATAATGGCACTGGTGGCAAGTCCATCTATGGGGAGAAATTTGAAGATGAGAACTTCATCCTAAAGCATACGGGTCCTGGCATCTTGTCCATGGCAAATGCTGGACCCAACACAAATGGTTCCCAGTTTTTCATCTGCACTGCCAAGACTGAGTGGTTGGATGGCAAGCATGTGGTGTTTGGCAAAGTGAAAGAAGGCATGAATATTGTGGAGGCCATGGAGCGCTTTGGGTCCAGGAATGGCAAGACCAGCAAGAAGATCACCATTGCTGACTGTGGACAACTCGAATAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T47081-Ab | Anti-PPIA/ CYPA/ CYPH functional antibody |
Target Antigen | GM-Tg-g-T47081-Ag | PPIA protein |
ORF Viral Vector | pGMAD000285 | Rat Ppia Adenovirus plasmid |
ORF Viral Vector | pGMPC001072 | Rat Ppia Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMAP000039 | Human PPIA Adenovirus plasmid |
ORF Viral Vector | vGMAD000285 | Rat Ppia Adenovirus particle |
ORF Viral Vector | vGMAP000039 | Human PPIA Adenovirus particle |
ORF Viral Vector | pGMLV002304 | Human PPIA Lentivirus plasmid |
ORF Viral Vector | pGMLV002305 | Human PPIA Lentivirus plasmid |
Target information
Target ID | GM-T47081 |
Target Name | PPIA |
Gene ID | 5478, 268373, 574102, 25518, 493966, 608151, 281418, 100052020 |
Gene Symbol and Synonyms | Cphn,CYCA,CyP-18,CyP-A,CYPA,CYPH,HEL-S-69p,MT-ND1,MTND1,NADH1,ND1,p1B15,p31,PPIA,SP18 |
Uniprot Accession | P62937 |
Uniprot Entry Name | PPIA_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000196262 |
Target Classification | Not Available |
This gene encodes a member of the peptidyl-prolyl cis-trans isomerase (PPIase) family. PPIases catalyze the cis-trans isomerization of proline imidic peptide bonds in oligopeptides and accelerate the folding of proteins. The encoded protein is a cyclosporin binding-protein and may play a role in cyclosporin A-mediated immunosuppression. The protein can also interact with several HIV proteins, including p55 gag, Vpr, and capsid protein, and has been shown to be necessary for the formation of infectious HIV virions. Multiple pseudogenes that map to different chromosomes have been reported. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.