Human INS ORF/cDNA clone-Adenovirus plasmid (BC005255)
Cat. No.: pGMAP000054
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human INS/ adenoviral expression plasmid for INS adenovirus packaging, INS adenovirus.
Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.
Go to
INS/ products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
| Catalog ID | pGMAP000054 |
| Gene Name | INS |
| Accession Number | BC005255 |
| Gene ID | 3630 |
| Species | Human |
| Product Type | Adenovirus plasmid (overexpression) |
| Insert Length | 333 bp |
| Gene Alias | |
| Fluorescent Reporter | GFP |
| Mammalian Cell Selection | Null |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | EF1 |
| Resistance | Kanamycin |
| ORF Nucleotide Sequence | ATGGCCCTGTGGATGCGCCTCCTGCCCCTGCTGGCGCTGCTGGCCCTCTGGGGACCTGACCCAGCCGCAGCCTTTGTGAACCAACACCTGTGCGGCTCACACCTGGTGGAAGCTCTCTACCTAGTGTGCGGGGAACGAGGCTTCTTCTACACACCCAAGACCCGCCGGGAGGCAGAGGACCTGCAGGTGGGGCAGGTGGAGCTGGGCGGGGGCCCTGGTGCAGGCAGCCTGCAGCCCTTGGCCCTGGAGGGGTCCCTGCAGAAGCGTGGCATTGTGGAACAATGCTGTACCAGCATCTGCTCCCTCTACCAGCTGGAGAACTACTGCAACTAG |
| ORF Protein Sequence | MALWMRLLPLLALLALWGPDPAAAFVNQHLCGSHLVEALYLVCGERGFFYTPKTRREAEDLQVGQVELGGGPGAGSLQPLALEGSLQKRGIVEQCCTSICSLYQLENYCN |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-T82841-Ab | Anti-INS/ IDDM/ IDDM1 functional antibody |
| Target Antigen | GM-Tg-g-T82841-Ag | INS protein |
| ORF Viral Vector | pGMAP000054 | Human INS Adenovirus plasmid |
| ORF Viral Vector | vGMAP000054 | Human INS Adenovirus particle |
Target information
| Target ID | GM-T82841 |
| Target Name | INS |
| Gene ID | 3630, 16334, 704534, 24506, 493804, 483665, 280829, 111776000 |
| Gene Symbol and Synonyms | CP-II,IDDM,IDDM1,IDDM2,ILPR,INS,Ins-2,Ins2,InsII,IRDN,Mody,MODY10,Mody4,PNDM4 |
| Uniprot Accession | P01308 |
| Uniprot Entry Name | INS_HUMAN |
| Protein Sub-location | Secreted Protein/Potential Cytokines |
| Category | Therapeutics Target, Diagnostics Biomarker |
| Disease | Not Available |
| Gene Ensembl | ENSG00000254647 |
| Target Classification | Not Available |
This gene encodes insulin, a peptide hormone that plays a vital role in the regulation of carbohydrate and lipid metabolism. After removal of the precursor signal peptide, proinsulin is post-translationally cleaved into three peptides: the B chain and A chain peptides, which are covalently linked via two disulfide bonds to form insulin, and C-peptide. Binding of insulin to the insulin receptor (INSR) stimulates glucose uptake. A multitude of mutant alleles with phenotypic effects have been identified, including insulin-dependent diabetes mellitus, permanent neonatal diabetes diabetes mellitus, maturity-onset diabetes of the young type 10 and hyperproinsulinemia. There is a read-through gene, INS-IGF2, which overlaps with this gene at the 5' region and with the IGF2 gene at the 3' region. [provided by RefSeq, May 2020]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


