Human BCL2L1/Bcl-X/bcl-xL ORF/cDNA clone-Adenovirus plasmid (BC019307)

Cat. No.: pGMAP000056
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human BCL2L1/Bcl-X/bcl-xL adenoviral expression plasmid for BCL2L1 adenovirus packaging, BCL2L1 adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.


Target products collection

Go to BCL-xL/BCL2L1/Bcl-X products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMAP000056
Gene Name BCL2L1
Accession Number BC019307
Gene ID 598
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 702 bp
Gene Alias Bcl-X,bcl-xL,BCL-XL/S,bcl-xS,BCL2L,BCLX
Fluorescent Reporter GFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Kanamycin
ORF Nucleotide Sequence ATGTCTCAGAGCAACCGGGAGCTGGTGGTTGACTTTCTCTCCTACAAGCTTTCCCAGAAAGGATACAGCTGGAGTCAGTTTAGTGATGTGGAAGAGAACAGGACTGAGGCCCCAGAAGGGACTGAATCGGAGATGGAGACCCCCAGTGCCATCAATGGCAACCCATCCTGGCACCTGGCAGACAGCCCCGCGGTGAATGGAGCCACTGGCCACAGCAGCAGTTTGGATGCCCGGGAGGTGATCCCCATGGCAGCAGTAAAGCAAGCGCTGAGGGAGGCAGGCGACGAGTTTGAACTGCGGTACCGGCGGGCATTCAGTGACCTGACATCCCAGCTCCACATCACCCCAGGGACAGCATATCAGAGCTTTGAACAGGTAGTGAATGAACTCTTCCGGGATGGGGTAAACTGGGGTCGCATTGTGGCCTTTTTCTCCTTCGGCGGGGCACTGTGCGTGGAAAGCGTAGACAAGGAGATGCAGGTATTGGTGAGTCGGATCGCAGCTTGGATGGCCACTTACCTGAATGACCACCTAGAGCCTTGGATCCAGGAGAACGGCGGCTGGGATACTTTTGTGGAACTCTATGGGAACAATGCAGCAGCCGAGAGCCGAAAGGGCCAGGAACGCTTCAACCGCTGGTTCCTGACGGGCATGACTGTGGCCGGCGTGGTTCTGCTGGGCTCACTCTTCAGTCGGAAATGA
ORF Protein Sequence MSQSNRELVVDFLSYKLSQKGYSWSQFSDVEENRTEAPEGTESEMETPSAINGNPSWHLADSPAVNGATGHSSSLDAREVIPMAAVKQALREAGDEFELRYRRAFSDLTSQLHITPGTAYQSFEQVVNELFRDGVNWGRIVAFFSFGGALCVESVDKEMQVLVSRIAAWMATYLNDHLEPWIQENGGWDTFVELYGNNAAAESRKGQERFNRWFLTGMTVAGVVLLGSLFSRK

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0048-Ab Anti-BCL-xL monoclonal antibody
    Target Antigen GM-Tg-g-IP0048-Ag BCL-xL/BCL2L1 protein
    ORF Viral Vector pGMLP000494 Human BCL2L1 Lentivirus plasmid
    ORF Viral Vector pGMLP005610 Human BCL2L1 Lentivirus plasmid
    ORF Viral Vector pGMLP005822 Human BCL2L1 Lentivirus plasmid
    ORF Viral Vector pGMAP000056 Human BCL2L1 Adenovirus plasmid
    ORF Viral Vector pGMPC001115 Human BCL2L1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLP000494 Human BCL2L1 Lentivirus particle
    ORF Viral Vector vGMLP005610 Human BCL2L1 Lentivirus particle
    ORF Viral Vector vGMLP005822 Human BCL2L1 Lentivirus particle
    ORF Viral Vector vGMAP000056 Human BCL2L1 Adenovirus particle


    Target information

    Target ID GM-IP0048
    Target Name BCL-xL
    Gene ID 598, 12048, 713035, 24888, 493701, 403618, 282152, 100053597
    Gene Symbol and Synonyms Bcl(X)L,Bcl-X,Bcl-XL,BCL-XL/S,bcl2-L-1,BCL2L,BCL2L1,BCLX,PPP1R52
    Uniprot Accession Q07817
    Uniprot Entry Name B2CL1_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000171552
    Target Classification Tumor-associated antigen (TAA)

    The protein encoded by this gene belongs to the BCL-2 protein family. BCL-2 family members form hetero- or homodimers and act as anti- or pro-apoptotic regulators that are involved in a wide variety of cellular activities. The proteins encoded by this gene are located at the outer mitochondrial membrane, and have been shown to regulate outer mitochondrial membrane channel (VDAC) opening. VDAC regulates mitochondrial membrane potential, and thus controls the production of reactive oxygen species and release of cytochrome C by mitochondria, both of which are the potent inducers of cell apoptosis. Alternative splicing results in multiple transcript variants encoding two different isoforms. The longer isoform acts as an apoptotic inhibitor and the shorter isoform acts as an apoptotic activator. [provided by RefSeq, Dec 2015]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.