Human BCL2L1/Bcl-X/bcl-xL ORF/cDNA clone-Adenovirus particle (BC019307)
Cat. No.: vGMAP000056
Pre-made Human BCL2L1/Bcl-X/bcl-xL Adenovirus for BCL2L1 overexpression in-vitro and in-vivo. The BCL2L1 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified BCL2L1-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go to
BCL-xL/BCL2L1/Bcl-X products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
vGMAP000056 | Human BCL2L1 Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
5E+10PFU (1E+10pfu/ml×5ml) | |||
1E+11PFU (1E+10pfu/ml×10ml) | |||
Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMAP000056 |
Gene Name | BCL2L1 |
Accession Number | BC019307 |
Gene ID | 598 |
Species | Human |
Product Type | Adenovirus particle (overexpression) |
Insert Length | 702 bp |
Gene Alias | Bcl-X,bcl-xL,BCL-XL/S,bcl-xS,BCL2L,BCLX |
Fluorescent Reporter | GFP |
Mammalian Cell Selection | Null |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | EF1 |
Resistance | Kanamycin |
ORF Nucleotide Sequence | ATGTCTCAGAGCAACCGGGAGCTGGTGGTTGACTTTCTCTCCTACAAGCTTTCCCAGAAAGGATACAGCTGGAGTCAGTTTAGTGATGTGGAAGAGAACAGGACTGAGGCCCCAGAAGGGACTGAATCGGAGATGGAGACCCCCAGTGCCATCAATGGCAACCCATCCTGGCACCTGGCAGACAGCCCCGCGGTGAATGGAGCCACTGGCCACAGCAGCAGTTTGGATGCCCGGGAGGTGATCCCCATGGCAGCAGTAAAGCAAGCGCTGAGGGAGGCAGGCGACGAGTTTGAACTGCGGTACCGGCGGGCATTCAGTGACCTGACATCCCAGCTCCACATCACCCCAGGGACAGCATATCAGAGCTTTGAACAGGTAGTGAATGAACTCTTCCGGGATGGGGTAAACTGGGGTCGCATTGTGGCCTTTTTCTCCTTCGGCGGGGCACTGTGCGTGGAAAGCGTAGACAAGGAGATGCAGGTATTGGTGAGTCGGATCGCAGCTTGGATGGCCACTTACCTGAATGACCACCTAGAGCCTTGGATCCAGGAGAACGGCGGCTGGGATACTTTTGTGGAACTCTATGGGAACAATGCAGCAGCCGAGAGCCGAAAGGGCCAGGAACGCTTCAACCGCTGGTTCCTGACGGGCATGACTGTGGCCGGCGTGGTTCTGCTGGGCTCACTCTTCAGTCGGAAATGA |
ORF Protein Sequence | MSQSNRELVVDFLSYKLSQKGYSWSQFSDVEENRTEAPEGTESEMETPSAINGNPSWHLADSPAVNGATGHSSSLDAREVIPMAAVKQALREAGDEFELRYRRAFSDLTSQLHITPGTAYQSFEQVVNELFRDGVNWGRIVAFFSFGGALCVESVDKEMQVLVSRIAAWMATYLNDHLEPWIQENGGWDTFVELYGNNAAAESRKGQERFNRWFLTGMTVAGVVLLGSLFSRK |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-IP0048-Ab | Anti-BCL-xL monoclonal antibody |
Target Antigen | GM-Tg-g-IP0048-Ag | BCL-xL/BCL2L1 protein |
ORF Viral Vector | pGMLP000494 | Human BCL2L1 Lentivirus plasmid |
ORF Viral Vector | pGMLP005610 | Human BCL2L1 Lentivirus plasmid |
ORF Viral Vector | pGMLP005822 | Human BCL2L1 Lentivirus plasmid |
ORF Viral Vector | pGMAP000056 | Human BCL2L1 Adenovirus plasmid |
ORF Viral Vector | pGMPC001115 | Human BCL2L1 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | vGMLP000494 | Human BCL2L1 Lentivirus particle |
ORF Viral Vector | vGMLP005610 | Human BCL2L1 Lentivirus particle |
ORF Viral Vector | vGMLP005822 | Human BCL2L1 Lentivirus particle |
ORF Viral Vector | vGMAP000056 | Human BCL2L1 Adenovirus particle |
Target information
Target ID | GM-IP0048 |
Target Name | BCL-xL |
Gene ID | 598, 12048, 713035, 24888, 493701, 403618, 282152, 100053597 |
Gene Symbol and Synonyms | Bcl(X)L,Bcl-X,Bcl-XL,BCL-XL/S,bcl2-L-1,BCL2L,BCL2L1,BCLX,PPP1R52 |
Uniprot Accession | Q07817 |
Uniprot Entry Name | B2CL1_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Cancer |
Gene Ensembl | ENSG00000171552 |
Target Classification | Tumor-associated antigen (TAA) |
The protein encoded by this gene belongs to the BCL-2 protein family. BCL-2 family members form hetero- or homodimers and act as anti- or pro-apoptotic regulators that are involved in a wide variety of cellular activities. The proteins encoded by this gene are located at the outer mitochondrial membrane, and have been shown to regulate outer mitochondrial membrane channel (VDAC) opening. VDAC regulates mitochondrial membrane potential, and thus controls the production of reactive oxygen species and release of cytochrome C by mitochondria, both of which are the potent inducers of cell apoptosis. Alternative splicing results in multiple transcript variants encoding two different isoforms. The longer isoform acts as an apoptotic inhibitor and the shorter isoform acts as an apoptotic activator. [provided by RefSeq, Dec 2015]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.