Human AQP1/AQP-CHIP/CHIP28 ORF/cDNA clone-Adenovirus plasmid (BC022486)
Cat. No.: pGMAP000072
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human AQP1/AQP-CHIP/CHIP28 adenoviral expression plasmid for AQP1 adenovirus packaging, AQP1 adenovirus.
Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.
Go to
AQP1/AQP-CHIP products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMAP000072 |
Gene Name | AQP1 |
Accession Number | BC022486 |
Gene ID | 358 |
Species | Human |
Product Type | Adenovirus plasmid (overexpression) |
Insert Length | 810 bp |
Gene Alias | AQP-CHIP,CHIP28,MGC26324 |
Fluorescent Reporter | GFP |
Mammalian Cell Selection | Null |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | EF1 |
Resistance | Kanamycin |
ORF Nucleotide Sequence | ATGGCCAGCGAGTTCAAGAAGAAGCTCTTCTGGAGGGCAGTGGTGGCCGAGTTCCTGGCCACGACCCTCTTTGTCTTCATCAGCATCGGTTCTGCCCTGGGCTTCAAATACCCGGTGGGGAACAACCAGACGACGGTCCAGGACAACGTGAAGGTGTCGCTGGCCTTCGGGCTGAGCATCGCCACGCTGGCGCAGAGTGTGGGCCACATCAGCGGCGCCCACCTCAACCCGGCTGTCACACTGGGGCTGCTGCTCAGCTGCCAGATCAGCATCTTCCGTGCCCTCATGTACATCATCGCCCAGTGCGTGGGGGCCATCGTCGCCACCGCCATCCTCTCAGGCATCACCTCCTCCCTGACTGGGAACTCGCTTGGCCGCAATGACCTGGCTGATGGTGTGAACTCGGGCCAGGGCCTGGGCATCGAGATCATCGGGACCCTCCAGCTGGTGCTATGCGTGCTGGCTACTACCGACCGGAGGCGCCGTGACCTTGGTGGCTCAGCCCCCCTTGCCATCGGCCTCTCTGTAGCCCTTGGACACCTCCTGGCTATTGACTACACTGGCTGTGGGATTAACCCTGCTCGGTCCTTTGGCTCCGCGGTGATCACACACAACTTCAGCAACCACTGGATTTTCTGGGTGGGGCCATTCATCGGGGGAGCCCTGGCTGTACTCATCTACGACTTCATCCTGGCCCCACGCAGCAGTGACCTCACAGACCGCGTGAAGGTGTGGACCAGCGGCCAGGTGGAGGAGTATGACCTGGATGCCGACGACATCAACTCCAGGGTGGAGATGAAGCCCAAATAG |
ORF Protein Sequence | MASEFKKKLFWRAVVAEFLATTLFVFISIGSALGFKYPVGNNQTTVQDNVKVSLAFGLSIATLAQSVGHISGAHLNPAVTLGLLLSCQISIFRALMYIIAQCVGAIVATAILSGITSSLTGNSLGRNDLADGVNSGQGLGIEIIGTLQLVLCVLATTDRRRRDLGGSAPLAIGLSVALGHLLAIDYTGCGINPARSFGSAVITHNFSNHWIFWVGPFIGGALAVLIYDFILAPRSSDLTDRVKVWTSGQVEEYDLDADDINSRVEMKPK |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T44057-Ab | Anti-AQP1/ AQP-CHIP/ CHIP28 monoclonal antibody |
Target Antigen | GM-Tg-g-T44057-Ag | AQP1 VLP (virus-like particle) |
ORF Viral Vector | pGMLV001070 | Human AQP1 Lentivirus plasmid |
ORF Viral Vector | pGMAP000072 | Human AQP1 Adenovirus plasmid |
ORF Viral Vector | vGMLV001070 | Human AQP1 Lentivirus particle |
ORF Viral Vector | vGMAP000072 | Human AQP1 Adenovirus particle |
Target information
Target ID | GM-T44057 |
Target Name | AQP1 |
Gene ID | 358, 11826, 106997467, 25240, 101087725, 403732, 282653, 100069916 |
Gene Symbol and Synonyms | AQP-1,AQP-CHIP,AQP1,CHIP28,CHIP29,CO |
Uniprot Accession | P29972 |
Uniprot Entry Name | AQP1_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target |
Disease | Renal cell carcinoma, Renal carcinoma |
Gene Ensembl | ENSG00000240583 |
Target Classification | Not Available |
This gene encodes a small integral membrane protein with six bilayer spanning domains that functions as a water channel protein. This protein permits passive transport of water along an osmotic gradient. This gene is a possible candidate for disorders involving imbalance in ocular fluid movement. [provided by RefSeq, Aug 2016]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.