Human AQP1/AQP-CHIP/CHIP28 ORF/cDNA clone-Adenovirus particle (BC022486)

Cat. No.: vGMAP000072

Pre-made Human AQP1/AQP-CHIP/CHIP28 Adenovirus for AQP1 overexpression in-vitro and in-vivo. The AQP1 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified AQP1-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collection

Go to AQP1/AQP-CHIP products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAP000072 Human AQP1 Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAP000072
Gene Name AQP1
Accession Number BC022486
Gene ID 358
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 810 bp
Gene Alias AQP-CHIP,CHIP28,MGC26324
Fluorescent Reporter GFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Kanamycin
ORF Nucleotide Sequence ATGGCCAGCGAGTTCAAGAAGAAGCTCTTCTGGAGGGCAGTGGTGGCCGAGTTCCTGGCCACGACCCTCTTTGTCTTCATCAGCATCGGTTCTGCCCTGGGCTTCAAATACCCGGTGGGGAACAACCAGACGACGGTCCAGGACAACGTGAAGGTGTCGCTGGCCTTCGGGCTGAGCATCGCCACGCTGGCGCAGAGTGTGGGCCACATCAGCGGCGCCCACCTCAACCCGGCTGTCACACTGGGGCTGCTGCTCAGCTGCCAGATCAGCATCTTCCGTGCCCTCATGTACATCATCGCCCAGTGCGTGGGGGCCATCGTCGCCACCGCCATCCTCTCAGGCATCACCTCCTCCCTGACTGGGAACTCGCTTGGCCGCAATGACCTGGCTGATGGTGTGAACTCGGGCCAGGGCCTGGGCATCGAGATCATCGGGACCCTCCAGCTGGTGCTATGCGTGCTGGCTACTACCGACCGGAGGCGCCGTGACCTTGGTGGCTCAGCCCCCCTTGCCATCGGCCTCTCTGTAGCCCTTGGACACCTCCTGGCTATTGACTACACTGGCTGTGGGATTAACCCTGCTCGGTCCTTTGGCTCCGCGGTGATCACACACAACTTCAGCAACCACTGGATTTTCTGGGTGGGGCCATTCATCGGGGGAGCCCTGGCTGTACTCATCTACGACTTCATCCTGGCCCCACGCAGCAGTGACCTCACAGACCGCGTGAAGGTGTGGACCAGCGGCCAGGTGGAGGAGTATGACCTGGATGCCGACGACATCAACTCCAGGGTGGAGATGAAGCCCAAATAG
ORF Protein Sequence MASEFKKKLFWRAVVAEFLATTLFVFISIGSALGFKYPVGNNQTTVQDNVKVSLAFGLSIATLAQSVGHISGAHLNPAVTLGLLLSCQISIFRALMYIIAQCVGAIVATAILSGITSSLTGNSLGRNDLADGVNSGQGLGIEIIGTLQLVLCVLATTDRRRRDLGGSAPLAIGLSVALGHLLAIDYTGCGINPARSFGSAVITHNFSNHWIFWVGPFIGGALAVLIYDFILAPRSSDLTDRVKVWTSGQVEEYDLDADDINSRVEMKPK

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T44057-Ab Anti-AQP1/ AQP-CHIP/ CHIP28 monoclonal antibody
    Target Antigen GM-Tg-g-T44057-Ag AQP1 VLP (virus-like particle)
    ORF Viral Vector pGMLV001070 Human AQP1 Lentivirus plasmid
    ORF Viral Vector pGMAP000072 Human AQP1 Adenovirus plasmid
    ORF Viral Vector vGMLV001070 Human AQP1 Lentivirus particle
    ORF Viral Vector vGMAP000072 Human AQP1 Adenovirus particle


    Target information

    Target ID GM-T44057
    Target Name AQP1
    Gene ID 358, 11826, 106997467, 25240, 101087725, 403732, 282653, 100069916
    Gene Symbol and Synonyms AQP-1,AQP-CHIP,AQP1,CHIP28,CHIP29,CO
    Uniprot Accession P29972
    Uniprot Entry Name AQP1_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Renal cell carcinoma, Renal carcinoma
    Gene Ensembl ENSG00000240583
    Target Classification Not Available

    This gene encodes a small integral membrane protein with six bilayer spanning domains that functions as a water channel protein. This protein permits passive transport of water along an osmotic gradient. This gene is a possible candidate for disorders involving imbalance in ocular fluid movement. [provided by RefSeq, Aug 2016]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.