Human TMED10/P24(DELTA)/S31I125 ORF/cDNA clone-Adenovirus plasmid (BC001496)

Cat. No.: pGMAP000155
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human TMED10/P24(DELTA)/S31I125 adenoviral expression plasmid for TMED10 adenovirus packaging, TMED10 adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to TMED10/P24(DELTA) products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMAP000155
Gene Name TMED10
Accession Number BC001496
Gene ID 10972
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 660 bp
Gene Alias P24(DELTA),S31I125,S31III125,Tmp-21-I,TMP21
Fluorescent Reporter GFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Kanamycin
ORF Nucleotide Sequence ATGTCTGGTTTGTCTGGCCCACCAGCCCGGCGCGGCCCTTTTCCGTTAGCGTTGCTGCTTTTGTTCCTGCTCGGCCCCAGATTGGTCCTTGCCATCTCCTTCCATCTGCCCATTAACTCTCGCAAGTGCCTCCGTGAGGAGATTCACAAGGACCTGCTAGTGACTGGCGCGTACGAGATCTCCGACCAGTCTGGGGGCGCTGGCGGCCTGCGCAGCCACCTCAAGATCACAGATTCTGCTGGCCATATTCTCTACTCCAAAGAGGATGCAACCAAGGGGAAATTTGCCTTTACCACTGAAGATTATGACATGTTTGAAGTGTGTTTTGAGAGCAAGGGAACAGGGCGGATACCTGACCAACTCGTGATCCTAGACATGAAGCATGGAGTGGAGGCGAAAAATTACGAAGAGATTGCAAAAGTTGAGAAGCTCAAACCATTAGAGGTAGAGCTGCGACGCCTAGAAGACCTTTCAGAATCTATTGTTAATGATTTTGCCTACATGAAGAAGAGAGAAGAGGAGATGCGTGATACCAACGAGTCAACAAACACTCGGGTCCTATACTTCAGCATCTTTTCAATGTTCTGTCTCATTGGACTAGCTACCTGGCAGGTCTTCTACCTGCGACGCTTCTTCAAGGCCAAGAAATTGATTGAGTAA
ORF Protein Sequence MSGLSGPPARRGPFPLALLLLFLLGPRLVLAISFHLPINSRKCLREEIHKDLLVTGAYEISDQSGGAGGLRSHLKITDSAGHILYSKEDATKGKFAFTTEDYDMFEVCFESKGTGRIPDQLVILDMKHGVEAKNYEEIAKVEKLKPLEVELRRLEDLSESIVNDFAYMKKREEEMRDTNESTNTRVLYFSIFSMFCLIGLATWQVFYLRRFFKAKKLIE

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP1807-Ab Anti-TMEDA/ TMED10/ P24(DELTA) monoclonal antibody
    Target Antigen GM-Tg-g-MP1807-Ag TMED10 VLP (virus-like particle)
    ORF Viral Vector pGMLP004242 Human TMED10 Lentivirus plasmid
    ORF Viral Vector pGMAP000155 Human TMED10 Adenovirus plasmid
    ORF Viral Vector vGMLP004242 Human TMED10 Lentivirus particle
    ORF Viral Vector vGMAP000155 Human TMED10 Adenovirus particle


    Target information

    Target ID GM-MP1807
    Target Name TMED10
    Gene ID 10972, 68581, 701522, 84599, 101097492, 610559, 529761, 100051561
    Gene Symbol and Synonyms 1110014C03Rik,p23,P24(DELTA),p24d1,p24delta1,S31I125,S31III125,TMED10,Tmp-21-I,TMP21
    Uniprot Accession P49755
    Uniprot Entry Name TMEDA_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000170348
    Target Classification Not Available

    This gene is a member of the EMP24/GP25L/p24 family and encodes a protein with a GOLD domain. This type I membrane protein is localized to the plasma membrane and golgi cisternae and is involved in vesicular protein trafficking. The protein is also a member of a heteromeric secretase complex and regulates the complex's gamma-secretase activity without affecting its epsilon-secretase activity. Mutations in this gene have been associated with early-onset familial Alzheimer's disease. This gene has a pseudogene on chromosome 8. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.