Human CDK4/CMM3/ MGC14458 ORF/cDNA clone-Adenovirus plasmid (BC003644)
Pre-made Human CDK4/CMM3/ MGC14458 adenoviral expression plasmid for CDK4 adenovirus packaging, CDK4 adenovirus.
Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.
Go
to CDK4/CMM3 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMAP000163 | Human CDK4 Adenovirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMAP000163 |
Gene Name | CDK4 |
Accession Number | BC003644 |
Gene ID | 1019 |
Species | Human |
Product Type | Adenovirus plasmid (overexpression) |
Insert Length | 912 bp |
Gene Alias | CMM3, MGC14458, PSK-J3 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGCTACCTCTCGATATGAGCCAGTGGCTGAAATTGGTGTCGGTGCCTATGGGACAGTGTACAAGGCCCGTGATCCCCACAGTGGCCACTTTGTGGCCCTCAAGAGTGTGAGAGTCCCCAATGGAGGAGGAGGTGGAGGAGGCCTTCCCATCAGCACAGTTCGTGAGGTGGCTTTACTGAGGCGACTGGAGGCTTTTGAGCATCCCAATGTTGTCCGGCTGATGGACGTCTGTGCCACATCCCGAACTGACCGGGAGATCAAGGTAACCCTGGTGTTTGAGCATGTAGACCAGGACCTAAGGACATATCTGGACAAGGCACCCCCACCAGGCTTGCCAGCCGAAACGATCAAGGATCTGATGCGCCAGTTTCTAAGAGGCCTAGATTTCCTTCATGCCAATTGCATCGTTCACCGAGATCTGAAGCCAGAGAACATTCTGGTGACAAGTGGTGGAACAGTCAAGCTGGCTGACTTTGGCCTGGCCAGAATCTACAGCTACCAGATGGCACTTACACCCGTGGTTGTTACACTCTGGTACCGAGCTCCCGAAGTTCTTCTGCAGTCCACATATGCAACACCTGTGGACATGTGGAGTGTTGGCTGTATCTTTGCAGAGATGTTTCGTCGAAAGCCTCTCTTCTGTGGAAACTCTGAAGCCGACCAGTTGGGCAAAATCTTTGACCTGATTGGGCTGCCTCCAGAGGATGACTGGCCTCGAGATGTATCCCTGCCCCGTGGAGCCTTTCCCCCCAGAGGGCCCCGCCCAGTGCAGTCGGTGGTACCTGAGATGGAGGAGTCGGGAGCACAGCTGCTGCTGGAAATGCTGACTTTTAACCCACACAAGCGAATCTCTGCCTTTCGAGCTCTGCAGCACTCTTATCTACATAAGGATGAAGGTAATCCGGAGTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T85799-Ab | Anti-CDK4 monoclonal antibody |
Target Antigen | GM-Tg-g-T85799-Ag | CDK4 protein |
ORF Viral Vector | pGMLV000900 | Human CDK4 Lentivirus plasmid |
ORF Viral Vector | pGMAP000163 | Human CDK4 Adenovirus plasmid |
ORF Viral Vector | vGMLV000900 | Human CDK4 Lentivirus particle |
ORF Viral Vector | vGMAP000163 | Human CDK4 Adenovirus particle |
Target information
Target ID | GM-T85799 |
Target Name | CDK4 |
Gene ID | 1019, 12567, 715650, 94201, 101097903, 481131, 510618, 100051005 |
Gene Symbol and Synonyms | CDK4,CMM3,Crk3,PSK-J3 |
Uniprot Accession | P11802 |
Uniprot Entry Name | CDK4_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Non-Small Cell Lung Cancer |
Gene Ensembl | ENSG00000135446 |
Target Classification | Kinase |
The protein encoded by this gene is a member of the Ser/Thr protein kinase family. This protein is highly similar to the gene products of S. cerevisiae cdc28 and S. pombe cdc2. It is a catalytic subunit of the protein kinase complex that is important for cell cycle G1 phase progression. The activity of this kinase is restricted to the G1-S phase, which is controlled by the regulatory subunits D-type cyclins and CDK inhibitor p16(INK4a). This kinase was shown to be responsible for the phosphorylation of retinoblastoma gene product (Rb). Mutations in this gene as well as in its related proteins including D-type cyclins, p16(INK4a) and Rb were all found to be associated with tumorigenesis of a variety of cancers. Multiple polyadenylation sites of this gene have been reported. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.