Human CDK4/CMM3/ MGC14458 ORF/cDNA clone-Adenovirus particle (BC003644)

Pre-made Human CDK4/CMM3/ MGC14458 Adenovirus for CDK4 overexpression in-vitro and in-vivo. The CDK4 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified CDK4-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collectionGo to CDK4/CMM3 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAP000163 Human CDK4 Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAP000163
Gene Name CDK4
Accession Number BC003644
Gene ID 1019
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 912 bp
Gene Alias CMM3, MGC14458, PSK-J3
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCTACCTCTCGATATGAGCCAGTGGCTGAAATTGGTGTCGGTGCCTATGGGACAGTGTACAAGGCCCGTGATCCCCACAGTGGCCACTTTGTGGCCCTCAAGAGTGTGAGAGTCCCCAATGGAGGAGGAGGTGGAGGAGGCCTTCCCATCAGCACAGTTCGTGAGGTGGCTTTACTGAGGCGACTGGAGGCTTTTGAGCATCCCAATGTTGTCCGGCTGATGGACGTCTGTGCCACATCCCGAACTGACCGGGAGATCAAGGTAACCCTGGTGTTTGAGCATGTAGACCAGGACCTAAGGACATATCTGGACAAGGCACCCCCACCAGGCTTGCCAGCCGAAACGATCAAGGATCTGATGCGCCAGTTTCTAAGAGGCCTAGATTTCCTTCATGCCAATTGCATCGTTCACCGAGATCTGAAGCCAGAGAACATTCTGGTGACAAGTGGTGGAACAGTCAAGCTGGCTGACTTTGGCCTGGCCAGAATCTACAGCTACCAGATGGCACTTACACCCGTGGTTGTTACACTCTGGTACCGAGCTCCCGAAGTTCTTCTGCAGTCCACATATGCAACACCTGTGGACATGTGGAGTGTTGGCTGTATCTTTGCAGAGATGTTTCGTCGAAAGCCTCTCTTCTGTGGAAACTCTGAAGCCGACCAGTTGGGCAAAATCTTTGACCTGATTGGGCTGCCTCCAGAGGATGACTGGCCTCGAGATGTATCCCTGCCCCGTGGAGCCTTTCCCCCCAGAGGGCCCCGCCCAGTGCAGTCGGTGGTACCTGAGATGGAGGAGTCGGGAGCACAGCTGCTGCTGGAAATGCTGACTTTTAACCCACACAAGCGAATCTCTGCCTTTCGAGCTCTGCAGCACTCTTATCTACATAAGGATGAAGGTAATCCGGAGTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T85799-Ab Anti-CDK4 monoclonal antibody
    Target Antigen GM-Tg-g-T85799-Ag CDK4 protein
    ORF Viral Vector pGMLV000900 Human CDK4 Lentivirus plasmid
    ORF Viral Vector pGMAP000163 Human CDK4 Adenovirus plasmid
    ORF Viral Vector vGMLV000900 Human CDK4 Lentivirus particle
    ORF Viral Vector vGMAP000163 Human CDK4 Adenovirus particle


    Target information

    Target ID GM-T85799
    Target Name CDK4
    Gene ID 1019, 12567, 715650, 94201, 101097903, 481131, 510618, 100051005
    Gene Symbol and Synonyms CDK4,CMM3,Crk3,PSK-J3
    Uniprot Accession P11802
    Uniprot Entry Name CDK4_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Non-Small Cell Lung Cancer
    Gene Ensembl ENSG00000135446
    Target Classification Kinase

    The protein encoded by this gene is a member of the Ser/Thr protein kinase family. This protein is highly similar to the gene products of S. cerevisiae cdc28 and S. pombe cdc2. It is a catalytic subunit of the protein kinase complex that is important for cell cycle G1 phase progression. The activity of this kinase is restricted to the G1-S phase, which is controlled by the regulatory subunits D-type cyclins and CDK inhibitor p16(INK4a). This kinase was shown to be responsible for the phosphorylation of retinoblastoma gene product (Rb). Mutations in this gene as well as in its related proteins including D-type cyclins, p16(INK4a) and Rb were all found to be associated with tumorigenesis of a variety of cancers. Multiple polyadenylation sites of this gene have been reported. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.