Human SMAD1/BSP1/ JV4-1 ORF/cDNA clone-Adenovirus plasmid (BC001878)

Pre-made Human SMAD1/BSP1/ JV4-1 adenoviral expression plasmid for SMAD1 adenovirus packaging, SMAD1 adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.

Target products collectionGo to SMAD1/BSP1 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMAP000218 Human SMAD1 Adenovirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMAP000218
Gene Name SMAD1
Accession Number BC001878
Gene ID 4086
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 1398 bp
Gene Alias BSP1, JV4-1, JV41, MADR1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAATGTGACAAGTTTATTTTCCTTTACAAGTCCAGCTGTGAAGAGACTTCTTGGGTGGAAACAGGGCGATGAAGAAGAAAAATGGGCAGAGAAAGCTGTTGATGCTTTGGTGAAAAAACTGAAGAAAAAGAAAGGTGCCATGGAGGAACTGGAAAAGGCCTTGAGCTGCCCAGGGCAACCGAGTAACTGTGTCACCATTCCCCGCTCTCTGGATGGCAGGCTGCAAGTCTCCCACCGGAAGGGACTGCCTCATGTCATTTACTGCCGTGTGTGGCGCTGGCCCGATCTTCAGAGCCACCATGAACTAAAACCACTGGAATGCTGTGAGTTTCCTTTTGGTTCCAAGCAGAAGGAGGTCTGCATCAATCCCTACCACTATAAGAGAGTAGAAAGCCCTGTACTTCCTCCTGTGCTGGTTCCAAGACACAGCGAATATAATCCTCAGCACAGCCTCTTAGCTCAGTTCCGTAACTTAGGACAAAATGAGCCTCACATGCCACTCAACGCCACTTTTCCAGATTCTTTCCAGCAACCCAACAGCCACCCGTTTCCTCACTCTCCCAATAGCAGTTACCCAAACTCTCCTGGGAGCAGCAGCAGCACCTACCCTCACTCTCCCACCAGCTCAGACCCAGGAAGCCCTTTCCAGATGCCAGCTGATACGCCCCCACCTGCTTACCTGCCTCCTGAAGACCCCATGACCCAGGATGGCTCTCAGCCGATGGACACAAACATGATGGCGCCTCCCCTGCCCTCAGAAATCAACAGAGGAGATGTTCAGGCGGTTGCTTATGAGGAACCAAAACACTGGTGCTCTATTGTCTACTATGAGCTCAACAATCGTGTGGGTGAAGCGTTCCATGCCTCCTCCACAAGTGTGTTGGTGGATGGTTTCACTGATCCTTCCAACAATAAGAACCGTTTCTGCCTTGGGCTGCTCTCCAATGTTAACCGGAATTCCACTATTGAAAACACCAGGCGGCATATTGGAAAAGGAGTTCATCTTTATTATGTTGGAGGGGAGGTGTATGCCGAATGCCTTAGTGACAGTAGCATCTTTGTGCAAAGTCGGAACTGCAACTACCATCATGGATTTCATCCTACTACTGTTTGCAAGATCCCTAGTGGGTGTAGTCTGAAAATTTTTAACAACCAAGAATTTGCTCAGTTATTGGCACAGTCTGTGAACCATGGATTTGAGACAGTCTATGAGCTTACAAAAATGTGTACTATACGTATGAGCTTTGTGAAGGGCTGGGGAGCAGAATACCACCGCCAGGATGTTACTAGCACCCCCTGCTGGATTGAGATACATCTGCACGGCCCCCTCCAGTGGCTGGATAAAGTTCTTACTCAAATGGGTTCACCTCATAATCCTATTTCATCTGTATCTTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP2743-Ab Anti-SMAD1 monoclonal antibody
    Target Antigen GM-Tg-g-IP2743-Ag SMAD1 protein
    Cytokine cks-Tg-g-GM-IP2743 SMAD family member 1 (SMAD1) protein & antibody
    ORF Viral Vector pGMLP000523 Human SMAD1 Lentivirus plasmid
    ORF Viral Vector pGMAP000218 Human SMAD1 Adenovirus plasmid
    ORF Viral Vector pGMLP-SPh-043 Human SMAD1 Lentivirus plasmid
    ORF Viral Vector pGMAP-SPh-183 Human SMAD1 Adenovirus plasmid
    ORF Viral Vector vGMLP000523 Human SMAD1 Lentivirus particle
    ORF Viral Vector vGMAP000218 Human SMAD1 Adenovirus particle
    ORF Viral Vector vGMLP-SPh-043 Human SMAD1 Lentivirus particle
    ORF Viral Vector vGMAP-SPh-183 Human SMAD1 Adenovirus particle
    ORF Viral Vector pGMLV002299 Human SMAD1 Lentivirus plasmid


    Target information

    Target ID GM-IP2743
    Target Name SMAD1
    Gene ID 4086, 17125, 574340, 25671, 101085713, 475456, 540488, 100033850
    Gene Symbol and Synonyms BSP-1,BSP1,dwf-A,JV4-1,JV41,Mad1,MADH1,MADR1,Mlp1,mMad1,MusMLP,SMAD1
    Uniprot Accession Q15797
    Uniprot Entry Name SMAD1_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Cytokine Target
    Disease Cancer
    Gene Ensembl ENSG00000170365
    Target Classification Tumor-associated antigen (TAA)

    The protein encoded by this gene belongs to the SMAD, a family of proteins similar to the gene products of the Drosophila gene 'mothers against decapentaplegic' (Mad) and the C. elegans gene Sma. SMAD proteins are signal transducers and transcriptional modulators that mediate multiple signaling pathways. This protein mediates the signals of the bone morphogenetic proteins (BMPs), which are involved in a range of biological activities including cell growth, apoptosis, morphogenesis, development and immune responses. In response to BMP ligands, this protein can be phosphorylated and activated by the BMP receptor kinase. The phosphorylated form of this protein forms a complex with SMAD4, which is important for its function in the transcription regulation. This protein is a target for SMAD-specific E3 ubiquitin ligases, such as SMURF1 and SMURF2, and undergoes ubiquitination and proteasome-mediated degradation. Alternatively spliced transcript variants encoding the same protein have been observed. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.