Human SMAD1/BSP1/ JV4-1 ORF/cDNA clone-Adenovirus plasmid (BC001878)
Pre-made Human SMAD1/BSP1/ JV4-1 adenoviral expression plasmid for SMAD1 adenovirus packaging, SMAD1 adenovirus.
Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.
Go
to SMAD1/BSP1 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMAP000218 | Human SMAD1 Adenovirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMAP000218 |
Gene Name | SMAD1 |
Accession Number | BC001878 |
Gene ID | 4086 |
Species | Human |
Product Type | Adenovirus plasmid (overexpression) |
Insert Length | 1398 bp |
Gene Alias | BSP1, JV4-1, JV41, MADR1 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAATGTGACAAGTTTATTTTCCTTTACAAGTCCAGCTGTGAAGAGACTTCTTGGGTGGAAACAGGGCGATGAAGAAGAAAAATGGGCAGAGAAAGCTGTTGATGCTTTGGTGAAAAAACTGAAGAAAAAGAAAGGTGCCATGGAGGAACTGGAAAAGGCCTTGAGCTGCCCAGGGCAACCGAGTAACTGTGTCACCATTCCCCGCTCTCTGGATGGCAGGCTGCAAGTCTCCCACCGGAAGGGACTGCCTCATGTCATTTACTGCCGTGTGTGGCGCTGGCCCGATCTTCAGAGCCACCATGAACTAAAACCACTGGAATGCTGTGAGTTTCCTTTTGGTTCCAAGCAGAAGGAGGTCTGCATCAATCCCTACCACTATAAGAGAGTAGAAAGCCCTGTACTTCCTCCTGTGCTGGTTCCAAGACACAGCGAATATAATCCTCAGCACAGCCTCTTAGCTCAGTTCCGTAACTTAGGACAAAATGAGCCTCACATGCCACTCAACGCCACTTTTCCAGATTCTTTCCAGCAACCCAACAGCCACCCGTTTCCTCACTCTCCCAATAGCAGTTACCCAAACTCTCCTGGGAGCAGCAGCAGCACCTACCCTCACTCTCCCACCAGCTCAGACCCAGGAAGCCCTTTCCAGATGCCAGCTGATACGCCCCCACCTGCTTACCTGCCTCCTGAAGACCCCATGACCCAGGATGGCTCTCAGCCGATGGACACAAACATGATGGCGCCTCCCCTGCCCTCAGAAATCAACAGAGGAGATGTTCAGGCGGTTGCTTATGAGGAACCAAAACACTGGTGCTCTATTGTCTACTATGAGCTCAACAATCGTGTGGGTGAAGCGTTCCATGCCTCCTCCACAAGTGTGTTGGTGGATGGTTTCACTGATCCTTCCAACAATAAGAACCGTTTCTGCCTTGGGCTGCTCTCCAATGTTAACCGGAATTCCACTATTGAAAACACCAGGCGGCATATTGGAAAAGGAGTTCATCTTTATTATGTTGGAGGGGAGGTGTATGCCGAATGCCTTAGTGACAGTAGCATCTTTGTGCAAAGTCGGAACTGCAACTACCATCATGGATTTCATCCTACTACTGTTTGCAAGATCCCTAGTGGGTGTAGTCTGAAAATTTTTAACAACCAAGAATTTGCTCAGTTATTGGCACAGTCTGTGAACCATGGATTTGAGACAGTCTATGAGCTTACAAAAATGTGTACTATACGTATGAGCTTTGTGAAGGGCTGGGGAGCAGAATACCACCGCCAGGATGTTACTAGCACCCCCTGCTGGATTGAGATACATCTGCACGGCCCCCTCCAGTGGCTGGATAAAGTTCTTACTCAAATGGGTTCACCTCATAATCCTATTTCATCTGTATCTTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-IP2743-Ab | Anti-SMAD1 monoclonal antibody |
Target Antigen | GM-Tg-g-IP2743-Ag | SMAD1 protein |
Cytokine | cks-Tg-g-GM-IP2743 | SMAD family member 1 (SMAD1) protein & antibody |
ORF Viral Vector | pGMLP000523 | Human SMAD1 Lentivirus plasmid |
ORF Viral Vector | pGMAP000218 | Human SMAD1 Adenovirus plasmid |
ORF Viral Vector | pGMLP-SPh-043 | Human SMAD1 Lentivirus plasmid |
ORF Viral Vector | pGMAP-SPh-183 | Human SMAD1 Adenovirus plasmid |
ORF Viral Vector | vGMLP000523 | Human SMAD1 Lentivirus particle |
ORF Viral Vector | vGMAP000218 | Human SMAD1 Adenovirus particle |
ORF Viral Vector | vGMLP-SPh-043 | Human SMAD1 Lentivirus particle |
ORF Viral Vector | vGMAP-SPh-183 | Human SMAD1 Adenovirus particle |
ORF Viral Vector | pGMLV002299 | Human SMAD1 Lentivirus plasmid |
Target information
Target ID | GM-IP2743 |
Target Name | SMAD1 |
Gene ID | 4086, 17125, 574340, 25671, 101085713, 475456, 540488, 100033850 |
Gene Symbol and Synonyms | BSP-1,BSP1,dwf-A,JV4-1,JV41,Mad1,MADH1,MADR1,Mlp1,mMad1,MusMLP,SMAD1 |
Uniprot Accession | Q15797 |
Uniprot Entry Name | SMAD1_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Cytokine Target |
Disease | Cancer |
Gene Ensembl | ENSG00000170365 |
Target Classification | Tumor-associated antigen (TAA) |
The protein encoded by this gene belongs to the SMAD, a family of proteins similar to the gene products of the Drosophila gene 'mothers against decapentaplegic' (Mad) and the C. elegans gene Sma. SMAD proteins are signal transducers and transcriptional modulators that mediate multiple signaling pathways. This protein mediates the signals of the bone morphogenetic proteins (BMPs), which are involved in a range of biological activities including cell growth, apoptosis, morphogenesis, development and immune responses. In response to BMP ligands, this protein can be phosphorylated and activated by the BMP receptor kinase. The phosphorylated form of this protein forms a complex with SMAD4, which is important for its function in the transcription regulation. This protein is a target for SMAD-specific E3 ubiquitin ligases, such as SMURF1 and SMURF2, and undergoes ubiquitination and proteasome-mediated degradation. Alternatively spliced transcript variants encoding the same protein have been observed. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.