Human PPARG/NR1C3/ PPARG1 ORF/cDNA clone-Adenovirus plasmid (BC006811)

Pre-made Human PPARG/NR1C3/ PPARG1 adenoviral expression plasmid for PPARG adenovirus packaging, PPARG adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.

Target products collectionGo to PPAR-gamma/PPARG/NR1C3 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMAP000222 Human PPARG Adenovirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMAP000222
Gene Name PPARG
Accession Number BC006811
Gene ID 5468
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 1434 bp
Gene Alias NR1C3, PPARG1, PPARG2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGACCATGGTTGACACAGAGATGCCATTCTGGCCCACCAACTTTGGGATCAGCTCCGTGGATCTCTCCGTAATGGAAGACCACTCCCACTCCTTTGATATCAAGCCCTTCACTACTGTTGACTTCTCCAGCATTTCTACTCCACATTACGAAGACATTCCATTCACAAGAACAGATCCAGTGGTTGCAGATTACAAGTATGACCTGAAACTTCAAGAGTACCAAAGTGCAATCAAAGTGGAGCCTGCATCTCCACCTTATTATTCTGAGAAGACTCAGCTCTACAATAAGCCTCATGAAGAGCCTTCCAACTCCCTCATGGCAATTGAATGTCGTGTCTGTGGAGATAAAGCTTCTGGATTTCACTATGGAGTTCATGCTTGTGAAGGATGCAAGGGTTTCTTCCGGAGAACAATCAGATTGAAGCTTATCTATGACAGATGTGATCTTAACTGTCGGATCCACAAAAAAAGTAGAAATAAATGTCAGTACTGTCGGTTTCAGAAATGCCTTGCAGTGGGGATGTCTCATAATGCCATCAGGTTTGGGCGGATGCCACAGGCCGAGAAGGAGAAGCTGTTGGCGGAGATCTCCAGTGATATCGACCAGCTGAATCCAGAGTCCGCTGACCTCCGGGCCCTGGCAAAACATTTGTATGACTCATACATAAAGTCCTTCCCGCTGACCAAAGCAAAGGCGAGGGCGATCTTGACAGGAAAGACAACAGACAAATCACCATTCGTTATCTATGACATGAATTCCTTAATGATGGGAGAAGATAAAATCAAGTTCAAACACATCACCCCCCTGCAGGAGCAGAGCAAAGAGGTGGCCATCCGCATCTTTCAGGGCTGCCAGTTTCGCTCCGTGGAGGCTGTGCAGGAGATCACAGAGTATGCCAAAAGCATTCCTGGTTTTGTAAATCTTGACTTGAACGACCAAGTAACTCTCCTCAAATATGGAGTCCACGAGATCATTTACACAATGCTGGCCTCCTTGATGAATAAAGATGGGGTTCTCATATCCGAGGGCCAAGGCTTCATGACAAGGGAGTTTCTAAAGAGCCTGCGAAAGCCTTTTGGTGACTTTATGGAGCCCAAGTTTGAGTTTGCTGTGAAGTTCAATGCACTGGAATTAGATGACAGCGACTTGGCAATATTTATTGCTGTCATTATTCTCAGTGGAGACCGCCCAGGTTTGCTGAATGTGAAGCCCATTGAAGACATTCAAGACAACCTGCTACAAGCCCTGGAGCTCCAGCTGAAGCTGAACCACCCTGAGTCCTCACAGCTGTTTGCCAAGCTGCTCCAGAAAATGACAGACCTCAGACAGATTGTCACGGAACACGTGCAGCTACTGCAGGTGATCAAGAAGACGGAGACAGACATGAGTCTTCACCCGCTCCTGCAGGAGATCTACAAGGACTTGTACTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T58921-Ab Anti-PPAR-gamma monoclonal antibody
    Target Antigen GM-Tg-g-T58921-Ag PPAR-gamma/PPARG protein
    ORF Viral Vector pGMLV000380 Rat Pparg Lentivirus plasmid
    ORF Viral Vector pGMAD000070 Rat Pparg Adenovirus plasmid
    ORF Viral Vector pGMAD000274 Human PPARG Adenovirus plasmid
    ORF Viral Vector pGMAD000670 Human PPARG Adenovirus plasmid
    ORF Viral Vector pGMPC000104 Human PPARG Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC000387 Rat Pparg Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC000794 Human PPARG Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC000893 Human PPARG Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMAP000222 Human PPARG Adenovirus plasmid
    ORF Viral Vector pGMLP-SPh-126 Human PPARG Lentivirus plasmid
    ORF Viral Vector pGMAP-SPh-266 Human PPARG Adenovirus plasmid
    ORF Viral Vector vGMLV000380 Rat Pparg Lentivirus particle
    ORF Viral Vector vGMAD000070 Rat Pparg Adenovirus particle
    ORF Viral Vector vGMAD000274 Human PPARG Adenovirus particle
    ORF Viral Vector vGMAD000670 Human PPARG Adenovirus particle
    ORF Viral Vector vGMAP000222 Human PPARG Adenovirus particle
    ORF Viral Vector vGMLP-SPh-126 Human PPARG Lentivirus particle
    ORF Viral Vector vGMAP-SPh-266 Human PPARG Adenovirus particle
    ORF Viral Vector pGMLV002517 Mouse Pparg Lentivirus plasmid


    Target information

    Target ID GM-T58921
    Target Name PPAR-gamma
    Gene ID 5468, 19016, 574190, 25664, 101095161, 403606, 281993, 100051258
    Gene Symbol and Synonyms CIMT1,GLM1,NR1C3,PPAR-gamma,PPAR-gamma2,PPARG,PPARG1,PPARG2,PPARG5,PPARgamma,PPARgamma2
    Uniprot Accession P37231
    Uniprot Entry Name PPARG_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000132170
    Target Classification Nuclear Receptors, Tumor-associated antigen (TAA)

    This gene encodes a member of the peroxisome proliferator-activated receptor (PPAR) subfamily of nuclear receptors. PPARs form heterodimers with retinoid X receptors (RXRs) and these heterodimers regulate transcription of various genes. Three subtypes of PPARs are known: PPAR-alpha, PPAR-delta, and PPAR-gamma. The protein encoded by this gene is PPAR-gamma and is a regulator of adipocyte differentiation. Additionally, PPAR-gamma has been implicated in the pathology of numerous diseases including obesity, diabetes, atherosclerosis and cancer. Alternatively spliced transcript variants that encode different isoforms have been described. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.